ID: 1100142388

View in Genome Browser
Species Human (GRCh38)
Location 12:91634250-91634272
Sequence CTGGGGAGGCTCTGGCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100142388_1100142398 7 Left 1100142388 12:91634250-91634272 CCTGCGCGCCAGAGCCTCCCCAG No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data
1100142388_1100142395 -1 Left 1100142388 12:91634250-91634272 CCTGCGCGCCAGAGCCTCCCCAG No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142388_1100142404 26 Left 1100142388 12:91634250-91634272 CCTGCGCGCCAGAGCCTCCCCAG No data
Right 1100142404 12:91634299-91634321 CTGGTCCCATCGACCGCCCAAGG No data
1100142388_1100142405 27 Left 1100142388 12:91634250-91634272 CCTGCGCGCCAGAGCCTCCCCAG No data
Right 1100142405 12:91634300-91634322 TGGTCCCATCGACCGCCCAAGGG No data
1100142388_1100142396 0 Left 1100142388 12:91634250-91634272 CCTGCGCGCCAGAGCCTCCCCAG No data
Right 1100142396 12:91634273-91634295 GATCGCCGCCCCCTGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100142388 Original CRISPR CTGGGGAGGCTCTGGCGCGC AGG (reversed) Intergenic