ID: 1100142389

View in Genome Browser
Species Human (GRCh38)
Location 12:91634251-91634273
Sequence CTGCGCGCCAGAGCCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100142384_1100142389 -8 Left 1100142384 12:91634236-91634258 CCCCGCCGTGGGCGCCTGCGCGC No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142373_1100142389 18 Left 1100142373 12:91634210-91634232 CCTGAGCCTCTTCTCCCCTACCC No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142381_1100142389 -3 Left 1100142381 12:91634231-91634253 CCCCACCCCGCCGTGGGCGCCTG No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142374_1100142389 12 Left 1100142374 12:91634216-91634238 CCTCTTCTCCCCTACCCCCACCC No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142383_1100142389 -5 Left 1100142383 12:91634233-91634255 CCACCCCGCCGTGGGCGCCTGCG No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142372_1100142389 23 Left 1100142372 12:91634205-91634227 CCATGCCTGAGCCTCTTCTCCCC No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142375_1100142389 4 Left 1100142375 12:91634224-91634246 CCCCTACCCCCACCCCGCCGTGG No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142382_1100142389 -4 Left 1100142382 12:91634232-91634254 CCCACCCCGCCGTGGGCGCCTGC No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142377_1100142389 3 Left 1100142377 12:91634225-91634247 CCCTACCCCCACCCCGCCGTGGG No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142386_1100142389 -10 Left 1100142386 12:91634238-91634260 CCGCCGTGGGCGCCTGCGCGCCA No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142371_1100142389 26 Left 1100142371 12:91634202-91634224 CCGCCATGCCTGAGCCTCTTCTC No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142379_1100142389 2 Left 1100142379 12:91634226-91634248 CCTACCCCCACCCCGCCGTGGGC No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142385_1100142389 -9 Left 1100142385 12:91634237-91634259 CCCGCCGTGGGCGCCTGCGCGCC No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142370_1100142389 27 Left 1100142370 12:91634201-91634223 CCCGCCATGCCTGAGCCTCTTCT No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data
1100142380_1100142389 -2 Left 1100142380 12:91634230-91634252 CCCCCACCCCGCCGTGGGCGCCT No data
Right 1100142389 12:91634251-91634273 CTGCGCGCCAGAGCCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100142389 Original CRISPR CTGCGCGCCAGAGCCTCCCC AGG Intergenic