ID: 1100142390

View in Genome Browser
Species Human (GRCh38)
Location 12:91634258-91634280
Sequence CGGCGATCCTGGGGAGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100142390_1100142408 25 Left 1100142390 12:91634258-91634280 CCAGAGCCTCCCCAGGATCGCCG No data
Right 1100142408 12:91634306-91634328 CATCGACCGCCCAAGGGCTGAGG No data
1100142390_1100142405 19 Left 1100142390 12:91634258-91634280 CCAGAGCCTCCCCAGGATCGCCG No data
Right 1100142405 12:91634300-91634322 TGGTCCCATCGACCGCCCAAGGG No data
1100142390_1100142395 -9 Left 1100142390 12:91634258-91634280 CCAGAGCCTCCCCAGGATCGCCG No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142390_1100142404 18 Left 1100142390 12:91634258-91634280 CCAGAGCCTCCCCAGGATCGCCG No data
Right 1100142404 12:91634299-91634321 CTGGTCCCATCGACCGCCCAAGG No data
1100142390_1100142396 -8 Left 1100142390 12:91634258-91634280 CCAGAGCCTCCCCAGGATCGCCG No data
Right 1100142396 12:91634273-91634295 GATCGCCGCCCCCTGCTCCAGGG No data
1100142390_1100142398 -1 Left 1100142390 12:91634258-91634280 CCAGAGCCTCCCCAGGATCGCCG No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100142390 Original CRISPR CGGCGATCCTGGGGAGGCTC TGG (reversed) Intergenic