ID: 1100142395

View in Genome Browser
Species Human (GRCh38)
Location 12:91634272-91634294
Sequence GGATCGCCGCCCCCTGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100142386_1100142395 11 Left 1100142386 12:91634238-91634260 CCGCCGTGGGCGCCTGCGCGCCA No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142384_1100142395 13 Left 1100142384 12:91634236-91634258 CCCCGCCGTGGGCGCCTGCGCGC No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142382_1100142395 17 Left 1100142382 12:91634232-91634254 CCCACCCCGCCGTGGGCGCCTGC No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142380_1100142395 19 Left 1100142380 12:91634230-91634252 CCCCCACCCCGCCGTGGGCGCCT No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142387_1100142395 8 Left 1100142387 12:91634241-91634263 CCGTGGGCGCCTGCGCGCCAGAG No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142390_1100142395 -9 Left 1100142390 12:91634258-91634280 CCAGAGCCTCCCCAGGATCGCCG No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142381_1100142395 18 Left 1100142381 12:91634231-91634253 CCCCACCCCGCCGTGGGCGCCTG No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142379_1100142395 23 Left 1100142379 12:91634226-91634248 CCTACCCCCACCCCGCCGTGGGC No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142375_1100142395 25 Left 1100142375 12:91634224-91634246 CCCCTACCCCCACCCCGCCGTGG No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142385_1100142395 12 Left 1100142385 12:91634237-91634259 CCCGCCGTGGGCGCCTGCGCGCC No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142377_1100142395 24 Left 1100142377 12:91634225-91634247 CCCTACCCCCACCCCGCCGTGGG No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142388_1100142395 -1 Left 1100142388 12:91634250-91634272 CCTGCGCGCCAGAGCCTCCCCAG No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data
1100142383_1100142395 16 Left 1100142383 12:91634233-91634255 CCACCCCGCCGTGGGCGCCTGCG No data
Right 1100142395 12:91634272-91634294 GGATCGCCGCCCCCTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100142395 Original CRISPR GGATCGCCGCCCCCTGCTCC AGG Intergenic