ID: 1100142398

View in Genome Browser
Species Human (GRCh38)
Location 12:91634280-91634302
Sequence GCCCCCTGCTCCAGGGCGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100142387_1100142398 16 Left 1100142387 12:91634241-91634263 CCGTGGGCGCCTGCGCGCCAGAG No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data
1100142386_1100142398 19 Left 1100142386 12:91634238-91634260 CCGCCGTGGGCGCCTGCGCGCCA No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data
1100142380_1100142398 27 Left 1100142380 12:91634230-91634252 CCCCCACCCCGCCGTGGGCGCCT No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data
1100142384_1100142398 21 Left 1100142384 12:91634236-91634258 CCCCGCCGTGGGCGCCTGCGCGC No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data
1100142381_1100142398 26 Left 1100142381 12:91634231-91634253 CCCCACCCCGCCGTGGGCGCCTG No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data
1100142392_1100142398 -10 Left 1100142392 12:91634267-91634289 CCCCAGGATCGCCGCCCCCTGCT No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data
1100142390_1100142398 -1 Left 1100142390 12:91634258-91634280 CCAGAGCCTCCCCAGGATCGCCG No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data
1100142382_1100142398 25 Left 1100142382 12:91634232-91634254 CCCACCCCGCCGTGGGCGCCTGC No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data
1100142388_1100142398 7 Left 1100142388 12:91634250-91634272 CCTGCGCGCCAGAGCCTCCCCAG No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data
1100142383_1100142398 24 Left 1100142383 12:91634233-91634255 CCACCCCGCCGTGGGCGCCTGCG No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data
1100142391_1100142398 -7 Left 1100142391 12:91634264-91634286 CCTCCCCAGGATCGCCGCCCCCT No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data
1100142385_1100142398 20 Left 1100142385 12:91634237-91634259 CCCGCCGTGGGCGCCTGCGCGCC No data
Right 1100142398 12:91634280-91634302 GCCCCCTGCTCCAGGGCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100142398 Original CRISPR GCCCCCTGCTCCAGGGCGAC TGG Intergenic