ID: 1100143837

View in Genome Browser
Species Human (GRCh38)
Location 12:91653085-91653107
Sequence TTTTGTAAGAGCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100143837_1100143845 30 Left 1100143837 12:91653085-91653107 CCTTCCACCTTGCTCTTACAAAA No data
Right 1100143845 12:91653138-91653160 CAGGTTCTGCACATGTATCCTGG No data
1100143837_1100143841 11 Left 1100143837 12:91653085-91653107 CCTTCCACCTTGCTCTTACAAAA No data
Right 1100143841 12:91653119-91653141 TACCTACCTAACAAACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100143837 Original CRISPR TTTTGTAAGAGCAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr