ID: 1100147930

View in Genome Browser
Species Human (GRCh38)
Location 12:91699983-91700005
Sequence TACTTTGAACTGAAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100147930_1100147933 7 Left 1100147930 12:91699983-91700005 CCAACCTCCTTCAGTTCAAAGTA No data
Right 1100147933 12:91700013-91700035 TGCCAAGATACCAGACTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100147930 Original CRISPR TACTTTGAACTGAAGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr