ID: 1100155608

View in Genome Browser
Species Human (GRCh38)
Location 12:91796628-91796650
Sequence CTAGATTTTAACAAACATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100155608_1100155612 5 Left 1100155608 12:91796628-91796650 CCACCATGTTTGTTAAAATCTAG No data
Right 1100155612 12:91796656-91796678 ATGCTCCTAATGACTGGAGGTGG No data
1100155608_1100155611 2 Left 1100155608 12:91796628-91796650 CCACCATGTTTGTTAAAATCTAG No data
Right 1100155611 12:91796653-91796675 ACTATGCTCCTAATGACTGGAGG No data
1100155608_1100155610 -1 Left 1100155608 12:91796628-91796650 CCACCATGTTTGTTAAAATCTAG No data
Right 1100155610 12:91796650-91796672 GACACTATGCTCCTAATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100155608 Original CRISPR CTAGATTTTAACAAACATGG TGG (reversed) Intergenic
No off target data available for this crispr