ID: 1100155609

View in Genome Browser
Species Human (GRCh38)
Location 12:91796631-91796653
Sequence TGTCTAGATTTTAACAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100155609_1100155611 -1 Left 1100155609 12:91796631-91796653 CCATGTTTGTTAAAATCTAGACA No data
Right 1100155611 12:91796653-91796675 ACTATGCTCCTAATGACTGGAGG No data
1100155609_1100155610 -4 Left 1100155609 12:91796631-91796653 CCATGTTTGTTAAAATCTAGACA No data
Right 1100155610 12:91796650-91796672 GACACTATGCTCCTAATGACTGG No data
1100155609_1100155612 2 Left 1100155609 12:91796631-91796653 CCATGTTTGTTAAAATCTAGACA No data
Right 1100155612 12:91796656-91796678 ATGCTCCTAATGACTGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100155609 Original CRISPR TGTCTAGATTTTAACAAACA TGG (reversed) Intergenic
No off target data available for this crispr