ID: 1100155610

View in Genome Browser
Species Human (GRCh38)
Location 12:91796650-91796672
Sequence GACACTATGCTCCTAATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100155608_1100155610 -1 Left 1100155608 12:91796628-91796650 CCACCATGTTTGTTAAAATCTAG No data
Right 1100155610 12:91796650-91796672 GACACTATGCTCCTAATGACTGG No data
1100155609_1100155610 -4 Left 1100155609 12:91796631-91796653 CCATGTTTGTTAAAATCTAGACA No data
Right 1100155610 12:91796650-91796672 GACACTATGCTCCTAATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100155610 Original CRISPR GACACTATGCTCCTAATGAC TGG Intergenic
No off target data available for this crispr