ID: 1100156085

View in Genome Browser
Species Human (GRCh38)
Location 12:91802046-91802068
Sequence ATAGCTGAAGCTCAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100156082_1100156085 21 Left 1100156082 12:91802002-91802024 CCCTCACAATCAATACATTATCA No data
Right 1100156085 12:91802046-91802068 ATAGCTGAAGCTCAGGAGACAGG No data
1100156083_1100156085 20 Left 1100156083 12:91802003-91802025 CCTCACAATCAATACATTATCAT No data
Right 1100156085 12:91802046-91802068 ATAGCTGAAGCTCAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100156085 Original CRISPR ATAGCTGAAGCTCAGGAGAC AGG Intergenic
No off target data available for this crispr