ID: 1100159160

View in Genome Browser
Species Human (GRCh38)
Location 12:91837619-91837641
Sequence GGCCTCTTTTTCCATGGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100159160_1100159163 9 Left 1100159160 12:91837619-91837641 CCTAAACCATGGAAAAAGAGGCC No data
Right 1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG No data
1100159160_1100159167 17 Left 1100159160 12:91837619-91837641 CCTAAACCATGGAAAAAGAGGCC No data
Right 1100159167 12:91837659-91837681 CCAGAAGAGTGAAGGCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100159160 Original CRISPR GGCCTCTTTTTCCATGGTTT AGG (reversed) Intergenic
No off target data available for this crispr