ID: 1100159161

View in Genome Browser
Species Human (GRCh38)
Location 12:91837625-91837647
Sequence TTATTAGGCCTCTTTTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100159161_1100159167 11 Left 1100159161 12:91837625-91837647 CCATGGAAAAAGAGGCCTAATAA No data
Right 1100159167 12:91837659-91837681 CCAGAAGAGTGAAGGCCTCTTGG No data
1100159161_1100159163 3 Left 1100159161 12:91837625-91837647 CCATGGAAAAAGAGGCCTAATAA No data
Right 1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100159161 Original CRISPR TTATTAGGCCTCTTTTTCCA TGG (reversed) Intergenic
No off target data available for this crispr