ID: 1100159163

View in Genome Browser
Species Human (GRCh38)
Location 12:91837651-91837673
Sequence ATGCCCATCCAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100159159_1100159163 10 Left 1100159159 12:91837618-91837640 CCCTAAACCATGGAAAAAGAGGC No data
Right 1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG No data
1100159161_1100159163 3 Left 1100159161 12:91837625-91837647 CCATGGAAAAAGAGGCCTAATAA No data
Right 1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG No data
1100159160_1100159163 9 Left 1100159160 12:91837619-91837641 CCTAAACCATGGAAAAAGAGGCC No data
Right 1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100159163 Original CRISPR ATGCCCATCCAGAAGAGTGA AGG Intergenic
No off target data available for this crispr