ID: 1100161667

View in Genome Browser
Species Human (GRCh38)
Location 12:91867777-91867799
Sequence CAGTGGTTCTAGAATCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100161667_1100161669 0 Left 1100161667 12:91867777-91867799 CCTTCTTGATTCTAGAACCACTG No data
Right 1100161669 12:91867800-91867822 TTCCCTTCGTGTTACCAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100161667 Original CRISPR CAGTGGTTCTAGAATCAAGA AGG (reversed) Intergenic
No off target data available for this crispr