ID: 1100162250

View in Genome Browser
Species Human (GRCh38)
Location 12:91874134-91874156
Sequence CTTAGTCATGTGTTGTATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100162248_1100162250 6 Left 1100162248 12:91874105-91874127 CCATCATAAAAACTAAGTATTAT No data
Right 1100162250 12:91874134-91874156 CTTAGTCATGTGTTGTATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100162250 Original CRISPR CTTAGTCATGTGTTGTATTA GGG Intergenic
No off target data available for this crispr