ID: 1100169115

View in Genome Browser
Species Human (GRCh38)
Location 12:91952994-91953016
Sequence AGCTGCCTGAGGCACCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100169115_1100169121 -4 Left 1100169115 12:91952994-91953016 CCTGTGTGGTGCCTCAGGCAGCT No data
Right 1100169121 12:91953013-91953035 AGCTCCAGGCAATAGGGAGAGGG No data
1100169115_1100169120 -5 Left 1100169115 12:91952994-91953016 CCTGTGTGGTGCCTCAGGCAGCT No data
Right 1100169120 12:91953012-91953034 CAGCTCCAGGCAATAGGGAGAGG No data
1100169115_1100169119 -10 Left 1100169115 12:91952994-91953016 CCTGTGTGGTGCCTCAGGCAGCT No data
Right 1100169119 12:91953007-91953029 TCAGGCAGCTCCAGGCAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100169115 Original CRISPR AGCTGCCTGAGGCACCACAC AGG (reversed) Intergenic
No off target data available for this crispr