ID: 1100170473

View in Genome Browser
Species Human (GRCh38)
Location 12:91969897-91969919
Sequence TAGTGAATTCTCGGGAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100170473_1100170479 4 Left 1100170473 12:91969897-91969919 CCAGATCTCCCGAGAATTCACTA No data
Right 1100170479 12:91969924-91969946 AATGACAGCACTAAGGGGAATGG No data
1100170473_1100170476 -3 Left 1100170473 12:91969897-91969919 CCAGATCTCCCGAGAATTCACTA No data
Right 1100170476 12:91969917-91969939 CTATTGCAATGACAGCACTAAGG No data
1100170473_1100170478 -1 Left 1100170473 12:91969897-91969919 CCAGATCTCCCGAGAATTCACTA No data
Right 1100170478 12:91969919-91969941 ATTGCAATGACAGCACTAAGGGG No data
1100170473_1100170477 -2 Left 1100170473 12:91969897-91969919 CCAGATCTCCCGAGAATTCACTA No data
Right 1100170477 12:91969918-91969940 TATTGCAATGACAGCACTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100170473 Original CRISPR TAGTGAATTCTCGGGAGATC TGG (reversed) Intergenic
No off target data available for this crispr