ID: 1100174941

View in Genome Browser
Species Human (GRCh38)
Location 12:92018863-92018885
Sequence TGTAATAGGTCCCATGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100174941_1100174945 17 Left 1100174941 12:92018863-92018885 CCTGCTTCATGGGACCTATTACA 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1100174945 12:92018903-92018925 ATGAACTATTATATTCCTCTTGG 0: 1
1: 0
2: 2
3: 23
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100174941 Original CRISPR TGTAATAGGTCCCATGAAGC AGG (reversed) Intronic
907183833 1:52593927-52593949 TGTACAAGGTCCCATGCTGCAGG + Intergenic
907715362 1:56921581-56921603 GGCAATAGGTCCCAGGCAGCAGG + Intergenic
908291677 1:62673445-62673467 TGTAATATGTTCCATGAAATAGG - Intronic
912112500 1:106360135-106360157 TTTCATAGTTCCCATGAATCAGG - Intergenic
915367208 1:155323130-155323152 GGTAAGAGGTCGCAAGAAGCGGG + Exonic
919794349 1:201312162-201312184 TGTAAAAGGGCCCAGGGAGCAGG + Intronic
1068738100 10:60437622-60437644 TTTAATAGGTTCCATGACCCTGG + Intronic
1069153752 10:64999233-64999255 TGTCCTAGGCCACATGAAGCTGG - Intergenic
1070998452 10:80807713-80807735 TGGAAGAGGTGCCAGGAAGCAGG - Intergenic
1073082092 10:100866797-100866819 TGTAATGGATCACATTAAGCAGG + Intergenic
1080791703 11:35527138-35527160 TGCAATAGGCCCCCAGAAGCAGG - Intronic
1086858315 11:91894069-91894091 TGTCAGAGGTCTAATGAAGCTGG + Intergenic
1088481280 11:110298083-110298105 CGTAATACTTCCCATGAAGTAGG + Intergenic
1091002644 11:131923299-131923321 TGTAATAGATCCCATGTCCCAGG - Intronic
1092027261 12:5252227-5252249 TTTAATAGATCACATGAAGTGGG - Intergenic
1098131895 12:67359772-67359794 TGTCCTAGGTCTCATGAAGCTGG + Intergenic
1100174941 12:92018863-92018885 TGTAATAGGTCCCATGAAGCAGG - Intronic
1102677014 12:114665822-114665844 TGTCATAGGTTCCTGGAAGCTGG + Intergenic
1108285790 13:48906840-48906862 GGTAACATGTCCCATGGAGCAGG + Intergenic
1108625840 13:52228240-52228262 TGTTATAGGTGCCATGGTGCCGG - Intergenic
1108660224 13:52578240-52578262 TGTTATAGGTGCCATGGTGCCGG + Intergenic
1109281147 13:60357046-60357068 TGAAAAAGGGACCATGAAGCAGG + Intergenic
1109793520 13:67279691-67279713 TGAAATAAGACCCCTGAAGCAGG - Intergenic
1109811495 13:67519043-67519065 TCTATTAGCTTCCATGAAGCTGG + Intergenic
1121676221 14:95755059-95755081 TGTCATAGGTGCCATGATGGAGG + Intergenic
1126229556 15:46309205-46309227 TGTAATAGTTCCAGTGAGGCAGG + Intergenic
1129483490 15:75845416-75845438 TGTAGTAGTTGTCATGAAGCAGG + Intronic
1134744036 16:16573631-16573653 GGTAATAGTACCCATGATGCAGG - Intergenic
1135001444 16:18780121-18780143 GGTAATAGTACCCATGATGCAGG + Intergenic
1138778234 16:59751354-59751376 TTTAATATGTCCCATGAGTCAGG + Intronic
1145809159 17:27754506-27754528 TGTACCAGGTCCCATGAATTTGG - Intergenic
1148214707 17:45828153-45828175 TTTTATAGGTCCCAAGAAGCAGG - Intronic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1149028347 17:52056020-52056042 TGTAGTAGTTCACATAAAGCAGG + Intronic
1151977104 17:77489234-77489256 TCTAAGGGGTCCCATGAGGCAGG - Intronic
1152076523 17:78163266-78163288 TTTAATAGGTCCCCTGAAGTAGG - Intronic
1152462629 17:80449532-80449554 TGTATTGGGTTCCATTAAGCTGG + Intergenic
1157249958 18:46086236-46086258 GGTAGCAGGTACCATGAAGCTGG - Exonic
1157451210 18:47790482-47790504 TGTCATAGGTCCCATAAATTAGG + Intergenic
1158485605 18:57863216-57863238 GTCAATAAGTCCCATGAAGCAGG - Intergenic
1163685054 19:18707929-18707951 TGTAAGATGTGCCATGAAGGGGG + Intronic
1165235038 19:34413978-34414000 GGTATTAGGTCCTATAAAGCAGG - Intronic
929620428 2:43348930-43348952 TGTAATAGGTCCCTTGGAGAAGG + Intronic
932334873 2:70924594-70924616 GGTAATAGTACCCATGAAGATGG + Intronic
935416568 2:102825352-102825374 TCTAATAGGTAACAAGAAGCAGG + Intronic
941334085 2:164219128-164219150 TGTAATAGCTCCCTTAAAGGAGG + Intergenic
941418351 2:165250290-165250312 TTTAATAGGTCACTTGAAGTAGG - Intronic
942661531 2:178270106-178270128 TGTGATAGGACCCCTGCAGCAGG + Intronic
1179496231 21:41772817-41772839 TGTGAGAGGTCACATGAAACTGG - Intergenic
1182044710 22:27265187-27265209 TGGAGTAAGTGCCATGAAGCAGG + Intergenic
949688572 3:6607819-6607841 TGTATTAGGTCACATAAACCTGG - Intergenic
957180377 3:76870021-76870043 TGCAATAGGTCCTAGGAAACTGG - Intronic
965671866 3:171156030-171156052 AGTAATTGGTCCCATGTTGCAGG - Intronic
965892706 3:173534500-173534522 TGTAATAATTGCCATGAAACCGG - Intronic
965969400 3:174535228-174535250 TGTAATAAGTACCATGAATATGG - Intronic
972347234 4:38202762-38202784 TGTTCTAGGTCCCAAGAATCTGG - Intergenic
975413706 4:74084195-74084217 TGTCATGGTTCCCATGAAGGAGG - Intergenic
976327174 4:83784951-83784973 TGCCATTGGTACCATGAAGCAGG + Intergenic
976889677 4:90031504-90031526 TGTGAGAGGTTGCATGAAGCAGG + Intergenic
977765336 4:100791025-100791047 TGTAATAGGCACCTTGAAGTCGG - Intronic
979129905 4:117030912-117030934 TGTGATAGTTCCCAGGAAGCTGG + Intergenic
981267057 4:142798327-142798349 GGTAATTGGGCCCATGAAGAAGG + Intronic
983618753 4:169737071-169737093 GGAAATAGTTCCCAAGAAGCAGG + Intronic
986042844 5:4010610-4010632 TGTGAGAGGTCCCCAGAAGCAGG + Intergenic
996330993 5:122328813-122328835 GGCCATGGGTCCCATGAAGCTGG - Intronic
996363112 5:122672444-122672466 AGTCATAGGTAGCATGAAGCAGG + Intergenic
997401095 5:133603184-133603206 GGTAGTAGGTCCCATGAATTTGG - Intronic
1000830735 5:166098061-166098083 TGAAATATGTCCCTTGATGCGGG - Intergenic
1004290376 6:14361608-14361630 TCCAATAGGTCCCAAGAAACAGG - Intergenic
1007154821 6:39732332-39732354 TTAAATAGGTCCCATGGAGGAGG - Intergenic
1009194288 6:60665799-60665821 TGCAATAGGTGCTATGAAGAAGG - Intergenic
1018163378 6:161069804-161069826 AGAAATAGCTCCCATGGAGCAGG + Intronic
1026546413 7:71327023-71327045 TGTAATAGATGGCCTGAAGCTGG + Intronic
1030223649 7:107125304-107125326 AGTGACAGATCCCATGAAGCAGG - Intronic
1031839713 7:126723262-126723284 TGTAAGAGGTCTCATGAAGGAGG - Intronic
1038560412 8:28573108-28573130 AGGAATAGGTCACATGAAGAGGG - Exonic
1044543145 8:93430181-93430203 TCTATTAATTCCCATGAAGCTGG + Intergenic
1045873954 8:106957337-106957359 TGTAATAGCCCACATGAAGCAGG - Intergenic
1053199932 9:36145374-36145396 TGTGATAGGTGCCAAGATGCAGG - Intronic
1054701429 9:68417205-68417227 TGCAGAAGGTCCCATGAAACAGG + Intronic
1055646644 9:78367719-78367741 TGTGATAGGTCACAAGAAGAGGG + Intergenic
1056682773 9:88733719-88733741 TGTTAGAGATCCCAGGAAGCAGG + Intergenic
1185916650 X:4042969-4042991 TATAATTGGTCCCATCAACCAGG + Intergenic
1196396726 X:115271648-115271670 AGTAATGGAACCCATGAAGCTGG + Intergenic
1199012645 X:142776014-142776036 TGTAAAAGGTGCAGTGAAGCAGG + Intergenic