ID: 1100176384

View in Genome Browser
Species Human (GRCh38)
Location 12:92035598-92035620
Sequence CTCAAAACTCTGCTTTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100176384 Original CRISPR CTCAAAACTCTGCTTTTCAC AGG (reversed) Intronic
900665272 1:3810974-3810996 TTCCAAACTCTGCTGTTCCCAGG - Intergenic
900859436 1:5217634-5217656 CTCCAAAGTCTGCTTCTCCCTGG + Intergenic
901266684 1:7915894-7915916 CACAAAACTATGATGTTCACAGG - Exonic
901648759 1:10730695-10730717 TCCAAAAGTCTGATTTTCACTGG - Intronic
903203430 1:21762495-21762517 CTTTCAACTCTGCTTTTCAAAGG + Intronic
903714377 1:25353213-25353235 CTCTAAACACTGCTTTTCTTTGG + Intronic
904391321 1:30188194-30188216 CTCCACACTATGCCTTTCACTGG + Intergenic
904847743 1:33432914-33432936 CCCAAAACTCTGGGATTCACAGG + Intergenic
906244398 1:44262877-44262899 CCCAAAACTCAGCCTTTCTCTGG + Intronic
906309656 1:44744602-44744624 CTTAAAACTCTGGTTTTCGCGGG + Intronic
907173633 1:52497343-52497365 CTCAAAACCCTGCTTCCCAAAGG - Intronic
907957949 1:59249437-59249459 CTGAAAACTCAGCTTTTCTTTGG - Intergenic
908056901 1:60297568-60297590 TTCAAAGCACTGCCTTTCACTGG + Intergenic
908706411 1:66961331-66961353 CTCAAAAATTTGATTTTCTCAGG - Intronic
909443514 1:75723945-75723967 CTCAAAACTCAGGGTCTCACTGG + Intergenic
909694120 1:78446024-78446046 CTCAAAACTCTACTATTTTCTGG + Intronic
909698384 1:78492066-78492088 CTCACCACTCTGCTTTTCATGGG + Intronic
909773302 1:79453478-79453500 CTCAAATCTCTACTTTCCATAGG - Intergenic
911930702 1:103899904-103899926 CTCCATGCTCTGCTTTCCACAGG - Intergenic
911964467 1:104349196-104349218 TTCAAACCTGTGCTTTTCAAGGG - Intergenic
918163853 1:181925708-181925730 CTCAAACCTTTCTTTTTCACTGG + Intergenic
918205981 1:182309853-182309875 CTCACACCTCTGCTTCTCCCAGG - Intergenic
918691886 1:187491098-187491120 CTTCAAACTCTGCTCTTCAATGG - Intergenic
918960951 1:191276885-191276907 AAGAAAACTCTGCTTTTAACAGG + Intergenic
921346813 1:214194784-214194806 CTCAATAGTCCACTTTTCACTGG - Intergenic
923667899 1:236014940-236014962 CTCATAACTCTCTTTTCCACTGG - Intronic
923969735 1:239186548-239186570 CTAAAAATTCTGCTGTTTACAGG - Intergenic
1063740378 10:8811485-8811507 GACAAAACTCTGCTTTTAAAGGG + Intergenic
1070163688 10:73881867-73881889 CTCAACACTGTGTTTTCCACTGG - Intergenic
1070481787 10:76890079-76890101 CTGTAAATTGTGCTTTTCACAGG - Intronic
1071004341 10:80865129-80865151 AATAAAACTTTGCTTTTCACTGG - Intergenic
1073576511 10:104630678-104630700 CTCCAAACTCCTCTTTCCACAGG - Intergenic
1074322908 10:112420222-112420244 CTCCCAACTCTGCCTATCACAGG + Intronic
1075557551 10:123444426-123444448 CTCAAGACTCTGTATTACACTGG - Intergenic
1078525433 11:12097355-12097377 CTCAGACCTCTTCTTTGCACTGG - Intronic
1078623793 11:12934919-12934941 CTCATCACTCTGCATTTCAGAGG - Intronic
1078804266 11:14681087-14681109 GTCAAAAGTGTGCTTTTCACTGG - Intronic
1078804267 11:14681124-14681146 GTCAAAAATGTGCTTTTCACTGG - Intronic
1079124645 11:17709836-17709858 CTCCAAAATCTGCTTATCCCTGG - Intergenic
1081336919 11:41878042-41878064 CTCAACACGCTGATTTTCCCAGG - Intergenic
1081472915 11:43393499-43393521 CTCAAAACTCTGTTGTTTAAGGG + Intronic
1086358855 11:86036435-86036457 CTCAAAACTATGCTCTTCACAGG + Intronic
1087065638 11:94025515-94025537 ATGAAAACCCTGCATTTCACTGG - Intronic
1087418020 11:97883552-97883574 CTTAAAACTCTGCTATTCCGGGG - Intergenic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1087807611 11:102572080-102572102 CTGAAAACCCTTCTTATCACAGG + Intergenic
1088878967 11:113958786-113958808 CTCACCACTTTGCTTTTCAGAGG - Intergenic
1090762050 11:129846610-129846632 ATCAAATCTCTGCTTTCCAGAGG + Intronic
1091617277 12:2059177-2059199 CTCACAGCTCTGCTTTTCTGTGG - Intronic
1091764176 12:3107462-3107484 CTTAAATCTCTGGGTTTCACAGG + Intronic
1093183364 12:15992082-15992104 TTCAAAACTGTGCTCTTCCCTGG + Intronic
1093987259 12:25549631-25549653 CCCAGAATTCTGCTTTTCAAAGG + Intronic
1096218985 12:49815991-49816013 CTCAAAGCTCTGCCTTTGTCTGG + Intronic
1098760230 12:74414851-74414873 TTCTTAACTCTGCTTTTTACTGG - Intergenic
1099111129 12:78562616-78562638 CTGAAAACAATGCTTTTCTCTGG + Intergenic
1099602907 12:84764055-84764077 ACCAAAACTCTGCTTCCCACAGG + Intergenic
1100176384 12:92035598-92035620 CTCAAAACTCTGCTTTTCACAGG - Intronic
1100607991 12:96167538-96167560 CTCCAAGCTCTGTTTCTCACAGG + Intergenic
1102739138 12:115190731-115190753 CTCCAAACTCTACTGTTTACTGG + Intergenic
1103039859 12:117685897-117685919 CGCAAATCTTTGCTTTTTACAGG - Intronic
1103173330 12:118841222-118841244 CTCAAACCTATGCTCTTAACAGG - Intergenic
1104038418 12:125114329-125114351 CTCCAAAGTCTGCTTCTCCCAGG + Intronic
1104062708 12:125281725-125281747 CTCAAAAGTCTTCTTAACACAGG - Intronic
1106041709 13:26099896-26099918 CTCAAAACTCTGCTATCCAGTGG - Intergenic
1107087342 13:36439957-36439979 CTGAAAACTCTTCCTTTCCCAGG + Exonic
1109771962 13:66986460-66986482 CTGAATAATCTGTTTTTCACTGG + Intronic
1110176037 13:72556304-72556326 TTCAAAATTCTGATTTTAACAGG - Intergenic
1113155468 13:107315375-107315397 GTTAAAACGCTGCTTTTCAGTGG + Intronic
1113389756 13:109884031-109884053 CCCTAACCTCTGCATTTCACTGG + Intergenic
1113448689 13:110390205-110390227 CTCCAAACTTTCCTCTTCACAGG - Intronic
1114041030 14:18678488-18678510 CCCAAAACTCTGTTCTCCACAGG + Intergenic
1115423972 14:33232835-33232857 CTTAAATATCTGCTTTGCACTGG - Intronic
1116210519 14:41935995-41936017 TTCAAAACACTTCTTTTCAAGGG + Intergenic
1116677832 14:47927784-47927806 CTCAAAAGTAAGCTTTTCTCAGG + Intergenic
1121052584 14:90829160-90829182 CTTAAAACTCCGCTTCTCTCTGG - Intergenic
1122116226 14:99528579-99528601 CTCAAAGGTTTGCTTTTCCCTGG - Intronic
1122189911 14:100033353-100033375 CTCTAGAATCTGCTTTTGACTGG - Intronic
1123180567 14:106466448-106466470 CTCATAACTGTTCTATTCACAGG + Intergenic
1202946332 14_KI270726v1_random:30213-30235 CTCATAACTGTTCTATTCACAGG - Intergenic
1124486954 15:30126154-30126176 CTCAAAATTCAGGTTTTCTCAGG - Intergenic
1124542037 15:30595129-30595151 CTCAAAATTCAGGTTTTCTCAGG - Intergenic
1124548684 15:30656921-30656943 CTCAAAATTCAGGTTTTCTCAGG - Intronic
1124756571 15:32412168-32412190 CTCAAAATTCAGGTTTTCTCAGG + Intergenic
1126019034 15:44381520-44381542 CCTTAAACTGTGCTTTTCACTGG + Intronic
1127591425 15:60428120-60428142 CCCACAACTTTGCTTTTCATAGG + Intronic
1127819218 15:62640468-62640490 CACAAACCCCTGCTTTACACAGG + Intronic
1127930720 15:63595570-63595592 CTCAAACCAATGCTTTTCAGAGG - Intergenic
1128418486 15:67469015-67469037 CTCAAAATACTCCTTTTCACTGG - Intronic
1131785710 15:95909096-95909118 TTCAGAACTCTGCCATTCACTGG + Intergenic
1133602621 16:7354546-7354568 TTCTAAACTCAGCTTTTCAAAGG + Intronic
1134899641 16:17925688-17925710 CTCCAAACTCTTCTTTACAGTGG + Intergenic
1135174072 16:20212623-20212645 CTCAAATATCTGCTTCCCACAGG - Intergenic
1135769461 16:25206076-25206098 CTGAAAATTTTGCTTTTAACAGG - Intergenic
1138254165 16:55538391-55538413 CTCAGAACTCTGCATGACACAGG - Intronic
1138511377 16:57510397-57510419 CTCAAAGCCCTGTTTTCCACTGG + Intergenic
1138862663 16:60776911-60776933 CTCAAATCTCTGTTTTTCAAGGG - Intergenic
1138946284 16:61854281-61854303 GTCAAGACCCTGCTTTCCACAGG + Intronic
1141743766 16:85912292-85912314 CTCTTAACTATGCTTTTCATGGG + Intronic
1142808776 17:2385668-2385690 CTCAACACCCTGCTTCTCCCGGG - Exonic
1146173984 17:30653162-30653184 CTCTATAATGTGCTTTTCACAGG + Intergenic
1146302518 17:31700745-31700767 CTCTTAGCTCTGCTTTTCAGAGG - Intergenic
1147488902 17:40845386-40845408 CTCAAAATTCTCCTCTCCACTGG - Intergenic
1147809953 17:43161383-43161405 CTTATAGCTATGCTTTTCACGGG + Intergenic
1148219066 17:45849595-45849617 CTCTCAGCTCTGCTTCTCACTGG + Intergenic
1156107012 18:33675536-33675558 CCCTGAACTCTGGTTTTCACTGG - Intronic
1157260576 18:46173242-46173264 CTCAAAACACTGCTTTGCTTTGG + Intergenic
1159502505 18:69292195-69292217 TTCAAAACCCTGCTGTTCAAGGG + Intergenic
1159946871 18:74450545-74450567 CTCCTCACTCTGCTTTTCACAGG - Intronic
1160115662 18:76076879-76076901 CTCCCAACTCTGCTTATGACAGG + Intergenic
1166137233 19:40785107-40785129 TTCAAAAATGTGCCTTTCACCGG - Intronic
1166229333 19:41416607-41416629 CTCTTAACACTCCTTTTCACCGG - Intronic
925933297 2:8728439-8728461 TGCAAAACTCTGCTTTAAACTGG - Intronic
926082855 2:10002933-10002955 CTCAAAACTCATCTCTTCCCGGG + Intergenic
927714947 2:25345658-25345680 CTCCAATCTCTGCTTTTGGCCGG - Intergenic
928866058 2:35918898-35918920 CTAATAACTATGCTTTTCTCAGG + Intergenic
930260758 2:49143459-49143481 CTGAAAATTCTTCTTGTCACAGG - Intronic
930387949 2:50721249-50721271 GGCAAAAATCTGCTGTTCACAGG - Intronic
930420198 2:51141745-51141767 TTCAAAACATTGCTTTTCATGGG - Intergenic
932014461 2:68010323-68010345 CTCAAGAATCTGCTTTTAAACGG - Intergenic
933968171 2:87447544-87447566 GTCAGGACTCTGCTTTTCAATGG + Intergenic
935088323 2:99869826-99869848 CTCAAAATCCTGCTCTTCTCTGG + Intronic
935958363 2:108400439-108400461 CTCAGAACTCTGCTTATGATAGG + Intergenic
936102207 2:109592111-109592133 CCCTAAACTCTGCCATTCACAGG + Intronic
936293769 2:111249146-111249168 CTCAAAGCTCAGCTTCTCACAGG - Intergenic
936325626 2:111502960-111502982 GTCAGGACTCTGCTTTTCAGTGG - Intergenic
936682962 2:114795595-114795617 TTCAAAACTCTGTTGTTCAAGGG - Intronic
937354791 2:121191499-121191521 GTCAAAACTTTGCTCTTCCCTGG + Intergenic
937538916 2:122924862-122924884 CTCAACACTCTGCTTATGATAGG - Intergenic
937764774 2:125648006-125648028 CTCAAAATTCTGCTTTGTAAAGG - Intergenic
941128800 2:161620802-161620824 CTCAAACCTCTGTTGTTCAAGGG - Intronic
942145941 2:173026249-173026271 CTGGAAACTCTTCTTTTCCCTGG - Intronic
942855988 2:180548677-180548699 ATCCTAACTCTGCTTTTCTCTGG - Intergenic
944902649 2:204231368-204231390 CTCTCAGCTCTGCTTTTCTCGGG - Intergenic
945932333 2:215867312-215867334 CTCATTATTCTGCTTGTCACAGG + Intergenic
946050268 2:216856312-216856334 CGGAAAACTCTGCTTTGCACTGG - Intergenic
946123010 2:217532903-217532925 ATCACAACTCTGCTGTTTACAGG + Intronic
948045631 2:234941415-234941437 CTCAAATCTGTGCTTCTCTCTGG + Intergenic
1168900727 20:1362596-1362618 CTCACAACTCTGGTTTTCCTGGG + Intronic
1168952723 20:1813550-1813572 CTCAAAACAATGCTTGACACAGG - Intergenic
1170015116 20:11771814-11771836 CTCAAAACTCTAATCTTCACAGG + Intergenic
1171222102 20:23407809-23407831 TTCACAGCTCTGCTGTTCACTGG - Intronic
1171879449 20:30606870-30606892 CTCCAAACTCTACTTCACACAGG + Intergenic
1173293860 20:41738470-41738492 GGAAAAACTATGCTTTTCACAGG - Intergenic
1173638597 20:44582770-44582792 CTCCAAGCTCTGCTTCTCCCTGG - Intronic
1173639631 20:44591631-44591653 CTGTACACTCTGCTTTACACTGG - Intronic
1174371844 20:50095374-50095396 CAGAAAATTCTGGTTTTCACAGG + Intronic
1176721135 21:10393886-10393908 CTCAACTCTCTGCTTCTCTCTGG - Intergenic
1177634881 21:23774425-23774447 CTCAAAACTCTGGTTATCAAAGG + Intergenic
1177838623 21:26212662-26212684 ATCACAACTCTGATTTTCTCTGG - Intergenic
1178583105 21:33852321-33852343 TTCAAAATTCTGCTTCTCATTGG + Intronic
1179563431 21:42231696-42231718 CTCCACACTCTGCCTTTAACCGG - Intronic
1180302324 22:11046676-11046698 CTCAACTCTCTGCTTCTCTCTGG - Intergenic
1180738400 22:18035786-18035808 CACATAACTCTGCATTTCATCGG + Intergenic
1181567753 22:23750215-23750237 CTCAAAACCCTTCATTTCAGAGG + Intronic
1182918078 22:34053864-34053886 CGCAAAACTCTGCTTGTCTTTGG + Intergenic
949796544 3:7857644-7857666 CTGCAAACTCTGCTTGTCAAAGG - Intergenic
950994804 3:17483468-17483490 CTCAAAACTTTGCATTTAAGTGG + Intronic
953111128 3:39939286-39939308 CTGAAAGCTCTGCTTTGAACTGG - Intronic
953311550 3:41885450-41885472 CTCAAAATTCAGGTTTTCTCAGG + Intronic
954695555 3:52423040-52423062 CTCAAGCCTCTGCTTCTCCCAGG - Intronic
955238060 3:57157228-57157250 GTCAACAAACTGCTTTTCACGGG + Intronic
955508324 3:59654198-59654220 TTAAAAACTCTGCTTTGCCCAGG - Intergenic
958467136 3:94472368-94472390 CTCACCACTCTGCTTTTGATAGG - Intergenic
962392415 3:134984195-134984217 CTCAGACCTCTGCTTTCCACTGG - Intronic
963419173 3:145037786-145037808 CCTGAAAGTCTGCTTTTCACCGG + Intergenic
964438538 3:156678302-156678324 CTCAGTACTCAGCTTATCACTGG - Exonic
964514578 3:157494089-157494111 CAAAAAACTCTTCTTTTCTCAGG - Intronic
964820388 3:160762462-160762484 AACATAACACTGCTTTTCACAGG - Intronic
965546985 3:169926390-169926412 CTCAAAACTCTCCTTCCCAGTGG + Intronic
965856135 3:173089965-173089987 CTAAAAAGCCTGCTTTTAACAGG + Intronic
967765449 3:193274351-193274373 CTCTAAACTTTCCTGTTCACTGG + Intronic
971393881 4:26210843-26210865 CCCATAACTAGGCTTTTCACTGG - Intronic
972223033 4:36978050-36978072 AACAAAGCTCTCCTTTTCACAGG + Intergenic
972992116 4:44833525-44833547 CTCAAAATTCTGTGTTTTACTGG + Intergenic
975841181 4:78475688-78475710 TTCCCAACTTTGCTTTTCACTGG + Intronic
976374468 4:84328378-84328400 CTCAAAACTGTGCTTCTCCTAGG - Intergenic
978561819 4:110042065-110042087 TTCAAAAAACTGATTTTCACTGG + Intergenic
979770507 4:124519317-124519339 CTCCAAATTCTTCTTTTCATGGG - Intergenic
980948174 4:139344292-139344314 ATCACAAATCTGCTTTTCATAGG - Exonic
982538045 4:156630970-156630992 CTCAAAACTTTACATTTCTCGGG + Intergenic
982965460 4:161901279-161901301 CTCAAATGTCTCCTCTTCACAGG - Intronic
984042918 4:174758864-174758886 CTCAGAACTATGTTTTTCAGGGG - Intronic
984729921 4:183058440-183058462 CTCAAAACTCTGGTTTGGGCTGG - Intergenic
984937464 4:184901656-184901678 CTCAGACCTCTGCATTTCAAAGG - Intergenic
987768298 5:22265115-22265137 CTCATACCTCTGCTGTTCTCTGG - Intronic
991231840 5:64342681-64342703 CTGAAAGCTGTGCTTTTCAGAGG - Intronic
996133938 5:119815911-119815933 CTGAAAACTCTGCTTCTCCCAGG + Intergenic
997534112 5:134603370-134603392 TTCAAAACCCAGCATTTCACAGG - Exonic
997649880 5:135508665-135508687 ATCAAAACACTTCTATTCACGGG - Intergenic
999128323 5:149263498-149263520 TACAAACCTGTGCTTTTCACTGG - Intergenic
1000217721 5:159179592-159179614 CTTAAAACTCTTCTTATCAGTGG - Intronic
1000398950 5:160805051-160805073 CTCAAACCTGTGCTATTCAAGGG + Intronic
1003123084 6:3333985-3334007 TTCAGAACACTGCTTTTCAAAGG - Intronic
1005586243 6:27279223-27279245 CTCAAAGCTCAGCTCTTCCCAGG - Intergenic
1007827532 6:44611943-44611965 CTTAAAATTCTGCCTATCACAGG - Intergenic
1008008827 6:46442025-46442047 ATCAAAACTCTGACTTTCTCTGG + Intronic
1008747652 6:54692096-54692118 GTCAAAACTCAGGTTTTCATTGG + Intergenic
1009967879 6:70596195-70596217 CTGTCAACTCTGCTTCTCACAGG - Intergenic
1010780816 6:79944592-79944614 CTGAAAACTGGGCTTTTCAGAGG - Intronic
1011072486 6:83400977-83400999 CTCAAAACTCACCTTCTCAATGG + Intronic
1012529446 6:100216539-100216561 ATCAAAACTCTTTCTTTCACAGG + Intergenic
1012714060 6:102646928-102646950 CTCAAATCGTTGCTCTTCACTGG + Intergenic
1014795132 6:125716203-125716225 TTCAAAACACTTCTTTTCATAGG - Intergenic
1018055504 6:160048852-160048874 AGCAAAACTCTCTTTTTCACAGG - Intronic
1018231534 6:161680414-161680436 CTCAGAACTCGGCCATTCACAGG - Intronic
1018268313 6:162050082-162050104 CTCAAAAGTCTCCTTTTCCTGGG + Intronic
1018973944 6:168549673-168549695 ATCAAAACTCTGTTGTTCAGGGG + Intronic
1019021586 6:168923189-168923211 CACAAAAGACTTCTTTTCACAGG + Intergenic
1019042535 6:169118806-169118828 CTCAACACTCTGCTTATAACAGG + Intergenic
1019062190 6:169264558-169264580 CTCAAAACTCATCATTGCACTGG - Intergenic
1019900207 7:4014418-4014440 CTGAAAACTTTGATATTCACAGG - Intronic
1020376339 7:7491648-7491670 CTCAAACCCCTACATTTCACAGG + Intronic
1021146193 7:17091952-17091974 CTCAAAACCCAGCTTTACACAGG + Intergenic
1022905236 7:34849385-34849407 CTCACAGCTCTCCTTCTCACTGG - Intronic
1028575878 7:92349872-92349894 CTCAGAACCCTGCTTTTAGCTGG + Intronic
1030548066 7:110923306-110923328 CTCAAAACAATGCTTTTTACCGG - Intronic
1031932871 7:127704046-127704068 CTCCTAACTCTGCTTTTAGCAGG + Intronic
1032428498 7:131841355-131841377 CTCTCAACTCTGCTTTCCTCTGG - Intergenic
1033514185 7:142089961-142089983 CTCAGAAATCTGCTTTTCATGGG - Intronic
1035233240 7:157479121-157479143 CTCACACCTGTGCTGTTCACAGG + Intergenic
1035427147 7:158786032-158786054 CTGAAAATTTTCCTTTTCACTGG + Intronic
1036171219 8:6487462-6487484 CTGGAATCTCAGCTTTTCACTGG + Intronic
1036389212 8:8310116-8310138 CTCATAAAACGGCTTTTCACTGG - Intergenic
1036623925 8:10449472-10449494 CTCAAATCTCTTCTTCTCACGGG + Intergenic
1039226476 8:35393670-35393692 CTCCAATCTATGCTTGTCACTGG - Intronic
1039559077 8:38498123-38498145 CTGAAACCACTGCTTTTCCCTGG - Intergenic
1041711577 8:60899389-60899411 CTCTCAGCTCTGCTTTTCTCTGG + Intergenic
1044163291 8:88948155-88948177 CTGATAACTCTGGTTGTCACTGG + Intergenic
1045308395 8:100979239-100979261 CTCTTAACAGTGCTTTTCACAGG - Intergenic
1046122977 8:109867935-109867957 ACCAACACTGTGCTTTTCACTGG + Intergenic
1046136242 8:110031405-110031427 CTAAAAACTTTGCTTTCTACAGG + Intergenic
1047258331 8:123233682-123233704 CTCAAAACCCTACTATTGACAGG - Intronic
1048091845 8:131249917-131249939 CTCACAACTCTGCTTCGCATTGG - Intergenic
1049503539 8:142982158-142982180 CTGAAAACATTGTTTTTCACTGG - Intergenic
1049974516 9:848852-848874 GCCAAAACTTTGCTTTTCATAGG + Intronic
1051744666 9:20283976-20283998 CCCAAAAAGCTGCTTTTCCCTGG + Intergenic
1051966594 9:22836002-22836024 CTCTCACCTCTCCTTTTCACAGG + Intergenic
1052071725 9:24090057-24090079 TTAAAAACTCTGCTTTACTCAGG + Intergenic
1052308280 9:27036274-27036296 TTCAAACCTCTGTTTTTCAAGGG + Intronic
1053826164 9:42026624-42026646 CTGAAAATTCTGCTTTGCAATGG - Intronic
1054604398 9:67160773-67160795 CTGAAAATTCTGCTTTGCAATGG + Intergenic
1055396359 9:75879237-75879259 TTCAACACTCTGATCTTCACTGG - Intergenic
1056667436 9:88592114-88592136 TTGGAAACTCTGCTTTTCAGTGG - Intergenic
1060104477 9:120865262-120865284 CTCAAAGCTCTGCTGACCACGGG + Intronic
1060864004 9:126980475-126980497 CTCAGGAATCTGCTTTTGACTGG + Intronic
1061130463 9:128705272-128705294 CTCCACCCTCTGCTTTCCACCGG + Intronic
1061580850 9:131535029-131535051 CTCAAAACCATGCTTTTCCCTGG - Intergenic
1185501528 X:600267-600289 CTCAGGACTCTGGTTTGCACAGG - Intergenic
1186139164 X:6552871-6552893 CTCCAAACTCTGCTTTCTATGGG + Intergenic
1187986012 X:24811811-24811833 CTCACAACTGTGATTTTTACAGG + Intronic
1188631327 X:32365199-32365221 GTCAATGCTCTCCTTTTCACAGG - Exonic
1189181088 X:39005101-39005123 CTCAAAACTCTGATATTCCAGGG - Intergenic
1190558088 X:51658085-51658107 CTACAAACTCTGCCTTTCACAGG - Intergenic
1194305457 X:92241715-92241737 CTCAAAATTCTGCTTTTCCTTGG + Intronic
1195994227 X:110715522-110715544 CTCAAAACCTTGGTTTTCTCAGG - Intronic
1196026047 X:111042397-111042419 CTCACATTTCTGTTTTTCACTGG - Intronic
1196633843 X:117976786-117976808 CTCTGAACTGTGCATTTCACAGG - Intronic
1198053055 X:132967308-132967330 GTCAATAAGCTGCTTTTCACAGG + Intergenic
1199866298 X:151853034-151853056 ATAAAAACTCTGTTTTTCAAAGG - Intergenic
1201598365 Y:15697933-15697955 CTGAAATGTGTGCTTTTCACTGG + Intergenic