ID: 1100177021

View in Genome Browser
Species Human (GRCh38)
Location 12:92042518-92042540
Sequence TTGCATTAACTAGCTAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100177021 Original CRISPR TTGCATTAACTAGCTAACAC AGG Intronic
902228383 1:15011567-15011589 ATGCAATAAGTAGGTAACACAGG - Intronic
903678894 1:25083875-25083897 TTGCATTAAATGGCTAAATCTGG - Intergenic
917382411 1:174427938-174427960 TTCCATTGACTAACCAACACAGG - Intronic
921809698 1:219498612-219498634 TTGCAGAAAATAACTAACACAGG - Intergenic
923895594 1:238266761-238266783 TAGCATTAAATAGAAAACACAGG + Intergenic
924020240 1:239773425-239773447 TTGAATTAACTACTTAACCCTGG + Intronic
924022114 1:239795002-239795024 ATCCATTAATTAGCTCACACTGG + Intronic
1073874887 10:107911281-107911303 ATGGATTAACTAGCTAATGCTGG + Intergenic
1090597167 11:128332661-128332683 TGGCATTAGCAAGCTAACGCAGG + Intergenic
1093289949 12:17307868-17307890 TTGCATTAGCTTCCTAACAATGG - Intergenic
1095886580 12:47194523-47194545 TTGCAATAAGTAGCTATCAAAGG - Intronic
1097596598 12:61640961-61640983 TTACACTATCTACCTAACACAGG - Intergenic
1098887675 12:75976730-75976752 TTGTATTAAGTAGCGACCACAGG - Intergenic
1100177021 12:92042518-92042540 TTGCATTAACTAGCTAACACAGG + Intronic
1100347132 12:93743171-93743193 TTCCATTAACTTAGTAACACAGG - Intronic
1105738000 13:23291970-23291992 CAGCATTTACTAGGTAACACTGG - Intronic
1107889146 13:44898854-44898876 CTGCACTGCCTAGCTAACACAGG + Intergenic
1109388274 13:61661892-61661914 TTTCACTAATTAGCAAACACAGG - Intergenic
1111828104 13:93294513-93294535 ATGCATGAACTACCTTACACAGG - Intronic
1113183933 13:107664471-107664493 TTGCATTAAATAGGAAACAATGG - Intronic
1117494841 14:56292839-56292861 TATCATTAACTAGCTAAAAAAGG - Intronic
1117703447 14:58438653-58438675 TTGCATTTACTACCTATCAACGG - Intronic
1119564604 14:75617905-75617927 CTGCATTGACTAGCTGAAACAGG + Intronic
1120909604 14:89654086-89654108 TTGCAATCATTAGCTTACACAGG + Intergenic
1126358337 15:47819622-47819644 TGGCATTAACTAGAGAACACTGG - Intergenic
1128205734 15:65850228-65850250 TTAAATTAAATAGCTGACACTGG + Intronic
1138886319 16:61083569-61083591 AAGCATTAACTCACTAACACTGG + Intergenic
1140279594 16:73542659-73542681 TTGTTTTAACTAGCTAAGTCTGG - Intergenic
1143596585 17:7917769-7917791 TGGCATTTACCAGCTATCACAGG + Intergenic
925027218 2:619766-619788 TTGCAGTAACTTGCTAGCCCTGG + Intergenic
928092682 2:28385258-28385280 TTGCATTAACCAGAGAACCCGGG + Intergenic
930729576 2:54714579-54714601 TTGCTCTTACTAGCAAACACTGG + Intergenic
931230397 2:60369689-60369711 AAGCATAAACTATCTAACACTGG + Intergenic
937071104 2:119064022-119064044 TTGCAATAGCTAGCTGATACAGG + Intergenic
942737155 2:179127495-179127517 TTACATTAAGTAGGTAACAGAGG + Intronic
946605191 2:221396678-221396700 TTGCCCTAACTTGCTGACACAGG + Intergenic
1169821788 20:9719669-9719691 TTGTATTAACTAGATGACCCAGG + Intronic
1175023494 20:55876438-55876460 TTGCATTAGCTATTTTACACAGG - Intergenic
1175186316 20:57181647-57181669 TTGCATTTACCTGCTAAGACTGG - Intronic
949213000 3:1528090-1528112 TTGCATTAAATGGCTCTCACCGG + Intergenic
949719875 3:6976488-6976510 TTGCAGAAACCAGGTAACACTGG - Intronic
949930474 3:9074473-9074495 TTCCACTAATTAACTAACACTGG + Intronic
954915203 3:54142991-54143013 AAGGAGTAACTAGCTAACACTGG + Intronic
956483516 3:69696927-69696949 TTGCCTTCAATAGCTAACATTGG + Intergenic
960363250 3:116739879-116739901 TTGAATTAACCAGGAAACACAGG + Intronic
961998741 3:131272775-131272797 TTCCATTAAAAAGCTAAAACTGG - Intronic
963423924 3:145098097-145098119 TTGCATTACCTAGTAATCACTGG + Intergenic
965072423 3:163932396-163932418 TTGCAATAACAAACTAACAAGGG + Intergenic
966953393 3:184846316-184846338 TACCATCAACTAGCTAAGACAGG - Intronic
972503589 4:39699011-39699033 TGGAATTAACTTGCTAACTCAGG - Intronic
974164792 4:58187639-58187661 ATGCATTCACTAGATAACACGGG - Intergenic
974251336 4:59389011-59389033 ATGTATTAAGTAACTAACACAGG + Intergenic
975773285 4:77754044-77754066 CTGCACTAACTAGCTAAAAGTGG - Intronic
976659422 4:87524093-87524115 TTGCATGACCTAGAAAACACTGG + Intronic
986250961 5:6058346-6058368 TTGCATCCAAAAGCTAACACAGG - Intergenic
988211959 5:28215423-28215445 TTTGATCAAATAGCTAACACAGG + Intergenic
988372581 5:30390332-30390354 TTCCATCAAGTAGCTAACATCGG + Intergenic
991826885 5:70635828-70635850 TTTTATTAACTATCTAGCACTGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
994560357 5:101362333-101362355 TTGCATTAAGTTTCCAACACAGG - Intergenic
995748632 5:115430375-115430397 CTGCATTAACCTGCTGACACTGG + Intergenic
996131859 5:119791200-119791222 GTCAATTAATTAGCTAACACAGG - Intergenic
1000227385 5:159278536-159278558 TTGGATGAACTAGCTAACTATGG - Intronic
1001215876 5:169855310-169855332 TTCCATTACCTATCTACCACAGG - Intronic
1001453507 5:171843848-171843870 TAGGATTAACCAGCTAACAGAGG - Intergenic
1004985258 6:21074698-21074720 TTTCATAAACTACCTAAGACTGG - Intronic
1007014090 6:38445446-38445468 TTACATTAACTTGATACCACTGG - Intronic
1008878666 6:56357392-56357414 ATGCACAAACTCGCTAACACTGG + Intronic
1011318886 6:86068019-86068041 TTGCACTAACTTTCTAACATTGG - Intergenic
1017484093 6:154887003-154887025 CTCCTTTAACTAACTAACACTGG + Intronic
1019035264 6:169049539-169049561 ATGTATTAACATGCTAACACTGG - Intergenic
1021949442 7:25760605-25760627 TTTCCTTAACAAACTAACACAGG + Intergenic
1033075343 7:138244807-138244829 TTGCATTGTCTAGCCAAGACTGG + Intergenic
1035811856 8:2498521-2498543 TTGGTATAACTAGCCAACACAGG - Intergenic
1036922387 8:12870112-12870134 TTTTATTAAGCAGCTAACACAGG - Intergenic
1040410119 8:47145440-47145462 TGGCATTAACAGGGTAACACAGG + Intergenic
1041579699 8:59444805-59444827 TTGTATTAACAACCAAACACAGG + Intergenic
1044863935 8:96551031-96551053 TTGCATGAACATGCTATCACTGG - Intronic
1050094147 9:2046931-2046953 TGGCATTCACTAACGAACACGGG - Intronic
1051159389 9:14189412-14189434 TTTCATTAACTAGTTGCCACTGG - Intronic
1051759892 9:20450630-20450652 TTGCATTAACTAGGCAATAGAGG - Intronic
1055105671 9:72510524-72510546 GAGCATTAAAAAGCTAACACTGG + Intergenic
1058112446 9:101046028-101046050 TTATATTAACTAACCAACACTGG + Intronic
1058258723 9:102803475-102803497 TTGCTTCTACTAGCGAACACTGG - Intergenic
1194030613 X:88809102-88809124 TGCCCTTAACAAGCTAACACAGG - Intergenic
1194901647 X:99519743-99519765 ATGCCTTAACTACCTACCACTGG + Intergenic