ID: 1100178069

View in Genome Browser
Species Human (GRCh38)
Location 12:92053232-92053254
Sequence CAACTGGAACAGTTTCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100178069_1100178074 14 Left 1100178069 12:92053232-92053254 CCCTGGGGAAACTGTTCCAGTTG 0: 1
1: 0
2: 2
3: 20
4: 159
Right 1100178074 12:92053269-92053291 CTCTTAAATGCCAAATCAAATGG 0: 1
1: 0
2: 2
3: 36
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100178069 Original CRISPR CAACTGGAACAGTTTCCCCA GGG (reversed) Intronic
901139503 1:7019271-7019293 CAACTTGAACAGTTTCCATAAGG + Intronic
901171794 1:7264184-7264206 CAACTGAATCAGAATCCCCAGGG - Intronic
901254227 1:7807450-7807472 AAACTGAAACAGTTTCCCAAAGG - Intronic
904041172 1:27586097-27586119 CAACTTCAAAAGTTTCCCCAAGG + Intronic
904497504 1:30895472-30895494 GAAGTGGAACAGCTTCCCCGGGG - Intronic
904500553 1:30910397-30910419 AAACTGGAACAATTCCCTCAAGG + Intergenic
907125825 1:52050010-52050032 GAACTGAAACAGCTTGCCCAAGG + Intronic
907675947 1:56518166-56518188 CATCTGGTACAGATTCCCCTTGG + Intronic
908117573 1:60954920-60954942 AAGCTGGAACAGTTACTCCAAGG + Intronic
910007589 1:82417588-82417610 CAAATGGAAAAGCTTCCCAAGGG + Intergenic
910052950 1:82997621-82997643 CAGCTGGGACAGTTTGACCAAGG - Intergenic
912210557 1:107552224-107552246 CAACTGGAACCCTTACCCCATGG - Intergenic
916571544 1:166032547-166032569 AACCTGGTACAGTTTCCTCAAGG + Intergenic
917421928 1:174872991-174873013 CAGGAGGAACAGTTTCTCCAGGG + Intronic
920502213 1:206492592-206492614 GAACAGGAACATTTTCCCCAAGG - Exonic
920679666 1:208062872-208062894 CCCCTGGCACAGTTTCCTCAGGG + Intronic
922454508 1:225763908-225763930 AAACTGGACCTTTTTCCCCAAGG + Intergenic
923702426 1:236312728-236312750 GTACTGGAACCGATTCCCCATGG + Intergenic
1062934259 10:1374507-1374529 CAACCGGAACAGCTTCCACTTGG - Intronic
1063244052 10:4200116-4200138 TCACTGGCACATTTTCCCCATGG - Intergenic
1068831208 10:61497346-61497368 CAAGTGGAACAGTTTTGCCCAGG + Intergenic
1068840826 10:61611969-61611991 CAACCTGAACATTTGCCCCAAGG - Intergenic
1069121391 10:64574018-64574040 CAAGTGAAGCACTTTCCCCAAGG - Intergenic
1070446396 10:76508563-76508585 CAAATGGAACAGTCTCCCAATGG - Intronic
1071787568 10:88919409-88919431 CAATTAGGACAGTTTTCCCATGG - Intronic
1072213406 10:93267790-93267812 GAACTGAAACAATTTGCCCAAGG + Intergenic
1074686075 10:115963590-115963612 AAGCTGGGAAAGTTTCCCCAAGG + Intergenic
1075104303 10:119527771-119527793 CAACAGCAACTGCTTCCCCATGG + Intronic
1075423412 10:122323349-122323371 CAAGTGGAACAGTCTTCTCAGGG + Intronic
1075902967 10:126057867-126057889 GAACGAGAACATTTTCCCCATGG + Intronic
1077517254 11:3009455-3009477 AAACTGGAACTCTGTCCCCATGG - Intronic
1079398583 11:20086983-20087005 CAACTGGAAGAGTTCTCCAAGGG + Intronic
1081086642 11:38810398-38810420 CTACTGGATCGGTTTCCCCAAGG - Intergenic
1081415701 11:42812518-42812540 CAGATGGAGCTGTTTCCCCAGGG - Intergenic
1082301501 11:50511396-50511418 CAACTCCAACATTTTCCCCTTGG + Intergenic
1083891549 11:65598185-65598207 CAGCTGCCTCAGTTTCCCCAGGG - Exonic
1084863292 11:72036575-72036597 AAACTAGAACAGTTTCCCCAAGG - Intronic
1087226715 11:95609390-95609412 CATATGTAACAGTTTTCCCAAGG + Intergenic
1087538954 11:99490758-99490780 GAAGTGGAACAGTTTATCCATGG + Intronic
1089268273 11:117282466-117282488 CAACTGGATAAGTTCCTCCATGG - Exonic
1090870723 11:130744799-130744821 CAACTGAAATAGTTGCCCTAAGG - Intergenic
1091890371 12:4049095-4049117 CACCTGCAACAGTTTCACCTTGG + Intergenic
1091890748 12:4052319-4052341 CAACTTTACCAGTTTTCCCAAGG + Intergenic
1091926205 12:4352323-4352345 CAAAAAGAACAGTTTTCCCAAGG + Exonic
1092138064 12:6163464-6163486 CACCAGGAACAGATTCACCAGGG - Intergenic
1097376019 12:58844017-58844039 CAGCAGGGTCAGTTTCCCCAGGG - Intergenic
1098888681 12:75985609-75985631 CAAGAGGAACAGTTTCACAATGG + Intergenic
1100151314 12:91741488-91741510 CCACTGGAACAGGTTCCAAAGGG - Intergenic
1100178069 12:92053232-92053254 CAACTGGAACAGTTTCCCCAGGG - Intronic
1100603924 12:96135423-96135445 CATCTGGAATACTTTCACCAAGG - Intergenic
1101020836 12:100552400-100552422 CAACTGCTAAACTTTCCCCAGGG - Intronic
1104332172 12:127857170-127857192 CAACTCTTAGAGTTTCCCCAGGG + Intergenic
1107984597 13:45764649-45764671 CAAAGGGAACAGTTTACACAAGG + Intergenic
1110787002 13:79540199-79540221 CAACTGGAACAGTGTCACTTGGG + Intronic
1113143650 13:107183195-107183217 CAACTGGACTTGTTCCCCCAGGG - Intronic
1116687238 14:48055651-48055673 CATCTGTAACAATTTCACCAGGG - Intergenic
1116957816 14:50942983-50943005 CAACTGTAACAGTTTTCAAATGG - Intronic
1117534986 14:56694959-56694981 CAAGTGGGAGAGTTCCCCCAGGG - Intronic
1118777972 14:68985638-68985660 TCACTGGAACAGTTTGCCCTAGG + Intergenic
1118985490 14:70751067-70751089 CAAATGGAAAAGTTTCACAAGGG + Intronic
1120654558 14:87173714-87173736 CAATTTGAGCAGTTTCTCCAGGG - Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1128121930 15:65155772-65155794 CAACTTGAACTGTTTCTCCACGG + Exonic
1129294859 15:74594608-74594630 CAACTGGGAGTGTTTCCTCAGGG + Intronic
1129683016 15:77668873-77668895 CAACAGGGAGAGGTTCCCCAAGG - Intronic
1130574668 15:85081343-85081365 CAACTGAAACAGACTCCCTAGGG - Intronic
1131022386 15:89109856-89109878 GAACTGGAACTATTTCCCCAAGG - Intronic
1131916768 15:97274447-97274469 CAACTGAAATATCTTCCCCAAGG - Intergenic
1132343191 15:101090917-101090939 TAACTGGAACAGATGGCCCAGGG + Intergenic
1133368044 16:5226504-5226526 AAACTGGAGCAGCTTGCCCAAGG + Intergenic
1135382162 16:22004321-22004343 CCACAGGAAAAGATTCCCCAGGG + Intergenic
1138267430 16:55669750-55669772 CCACTGGAGCAGATTCCCCAAGG - Intronic
1143317503 17:6043626-6043648 CAACTGGAACTGCTGCCCAAAGG + Intronic
1144892425 17:18501563-18501585 CAGCTGGTACAGTTTGCGCATGG - Intergenic
1145075325 17:19850122-19850144 AAAGTGGAAGTGTTTCCCCAAGG - Intronic
1145139789 17:20442725-20442747 CAGCTGGTACAGTTTGCGCATGG + Intergenic
1145796071 17:27655953-27655975 CAGCTGGTACAGTTTGCACATGG - Intergenic
1145810521 17:27761272-27761294 CAGCTGGTACAGTTTGCGCATGG - Intronic
1152807860 17:82365539-82365561 GAACTGGAACCTTTTCCCAAAGG + Intergenic
1155222604 18:23698857-23698879 CAACGGCTACAGTCTCCCCATGG - Intronic
1156570930 18:38252261-38252283 CAACTGGATCAGATTCTCAAAGG - Intergenic
1162600285 19:11663718-11663740 CAGCTGGAACATCTTACCCAAGG - Intergenic
1166046597 19:40234017-40234039 CAGCTGGGGCCGTTTCCCCAGGG - Intronic
1166562609 19:43743225-43743247 CAACTAGCAAATTTTCCCCATGG - Intronic
1168314515 19:55478673-55478695 CAGCTGCAACAGCCTCCCCACGG - Intronic
927192645 2:20527393-20527415 CTACTGCCTCAGTTTCCCCATGG - Intergenic
927307679 2:21592239-21592261 AAACTGGAACACATTCCTCAAGG + Intergenic
927741773 2:25576757-25576779 CACCTGGGCCAGTTTCCTCATGG - Intronic
929020754 2:37550276-37550298 CAAGTGGAAGCTTTTCCCCATGG + Intergenic
930032661 2:47068080-47068102 CAACGGGCACAGATTACCCAAGG - Intronic
931891345 2:66675902-66675924 CAGCAGGAACAGTATCCCCTGGG + Intergenic
932412038 2:71553306-71553328 CAGCTGGAACAGGTTTGCCAGGG - Intronic
932996925 2:76866350-76866372 CATCTTGAACATTTTCCTCAGGG + Intronic
935017618 2:99198988-99199010 TAACTGGCACAGTTTCACCAAGG + Intronic
935943374 2:108264758-108264780 CAAATGGAACATCATCCCCAAGG + Intronic
938930355 2:136081510-136081532 TCACTGGAACAGTGTCCACAAGG + Intergenic
939057858 2:137384781-137384803 CTCCTAGAGCAGTTTCCCCATGG - Intronic
940495816 2:154426922-154426944 CTACTAGAACAGTTTCCATAGGG + Intronic
943615244 2:190084934-190084956 AAACTAGAAAAGTTTTCCCATGG - Intronic
945412801 2:209532493-209532515 CAAGTTAAACAATTTCCCCAGGG + Intronic
949036474 2:241817753-241817775 CCACTGGGGCTGTTTCCCCAGGG + Intergenic
1169962578 20:11177929-11177951 CATCTGGATTAGCTTCCCCAAGG - Intergenic
1171369573 20:24652850-24652872 CATCTGGAAGAGTATTCCCAGGG - Intronic
1173668795 20:44783112-44783134 GAACTGAAGCAGTTTGCCCAAGG + Intronic
1174522219 20:51140603-51140625 TAACTGTAACATTTTCTCCAAGG - Intergenic
1175862052 20:62155784-62155806 CAACTGAATCAGTGCCCCCAGGG - Intronic
1175979422 20:62729570-62729592 CAACTGGATCAGAATCTCCAGGG + Intronic
1176841207 21:13844687-13844709 TTACTGGAACAGCTTCTCCATGG + Intergenic
1176984242 21:15418112-15418134 TAACAGGCTCAGTTTCCCCATGG - Intergenic
949659748 3:6264851-6264873 CAGCTTGTTCAGTTTCCCCAAGG + Intergenic
950316855 3:12009501-12009523 GAAATGGAACATTTTGCCCAAGG + Intronic
954698745 3:52440994-52441016 CAAATGGAGCACTTTCCTCAAGG - Exonic
954699575 3:52444161-52444183 CAACTGGCACTTTTTGCCCAGGG - Intronic
955986636 3:64580583-64580605 GAAATGGATCAGTTTCCCCCTGG - Intronic
957191165 3:77011462-77011484 CAAATGGACCAGTTTCTCCATGG - Intronic
958015359 3:87934007-87934029 CAGCAGGAACAGTTTTCCCAGGG - Intergenic
962387121 3:134940569-134940591 CAACCAGAACAAGTTCCCCAGGG - Intronic
964281485 3:155071341-155071363 CACATGGAACAGTTTAGCCAGGG + Intronic
966023416 3:175244223-175244245 CAACTTTATCAGTTTTCCCATGG - Intronic
976447806 4:85151687-85151709 CCTCTGGAACAGTTTTCCCAGGG + Intergenic
977035388 4:91944580-91944602 CCAATGGAAGAGTTTCCCCTTGG + Intergenic
977111529 4:92962565-92962587 CAAGTTAAACAGTTTCCCCAGGG + Intronic
978423306 4:108556803-108556825 AACTTGGAACAATTTCCCCAGGG - Intergenic
978620048 4:110628919-110628941 CAACTGGTACAATTTCCCCTGGG + Intronic
980568588 4:134579793-134579815 CAACTGGGACAGTTTGCCTGGGG + Intergenic
980694538 4:136337788-136337810 CAATTGGTACAGTTGGCCCAGGG - Intergenic
980913497 4:139014151-139014173 CAAAGGGAACATTTTTCCCATGG + Intergenic
983236344 4:165184662-165184684 GAACTTAAACATTTTCCCCAGGG + Intronic
983413855 4:167430497-167430519 CAAGTTTAGCAGTTTCCCCAGGG + Intergenic
983912650 4:173257219-173257241 CATTTGTGACAGTTTCCCCATGG + Intronic
985031012 4:185789949-185789971 CAACTGGAGCAGTGCCTCCATGG + Intronic
985857002 5:2436219-2436241 AAACTGCAACAGCTTCCCCATGG + Intergenic
990631178 5:57671601-57671623 TAACTGTGACAGTTTCCCAAAGG + Intergenic
990707939 5:58551079-58551101 GAACTGAAATACTTTCCCCAGGG + Intronic
994103219 5:95916611-95916633 CCACTGAAACTGCTTCCCCAAGG - Intronic
999481920 5:151956511-151956533 CATCTGCAACAGTTCCACCAGGG - Intergenic
999858234 5:155618397-155618419 GAACTTGAGAAGTTTCCCCAAGG + Intergenic
1001170990 5:169418812-169418834 CAACTGGATCACTCTGCCCATGG - Intergenic
1002422926 5:179158971-179158993 CACCTGGAACAGATTCCCAGTGG - Intronic
1003117314 6:3291641-3291663 CTACAGGCACAGTTTCTCCATGG + Intronic
1003398709 6:5774526-5774548 AAACTGGAACAGATCCCACAGGG + Intergenic
1003557068 6:7149589-7149611 CACCTGGAATAGTGTCCACATGG + Intronic
1008087294 6:47258463-47258485 ACACTGGAACAGTTTCCCCAGGG + Intronic
1008493253 6:52107377-52107399 CAGCTGGAGCTGTTTTCCCAGGG + Intergenic
1009741178 6:67748019-67748041 GAACTGGACCAGTTTCCCTTTGG - Intergenic
1011097330 6:83680905-83680927 AAGCTGGGACAGTTTCCCCGGGG - Intronic
1012503742 6:99920560-99920582 TCACTGTAACAGTTTCCTCAAGG - Exonic
1015491415 6:133830396-133830418 CACCTGGAATAGTGTGCCCAGGG + Intergenic
1016675192 6:146756969-146756991 CACCTGCATCAGCTTCCCCAAGG + Intronic
1017042780 6:150321240-150321262 CAATTGGAACTTTTTTCCCAAGG + Intergenic
1022506815 7:30912663-30912685 CAGCGGGCAAAGTTTCCCCAGGG - Intronic
1024918476 7:54530880-54530902 CAGCTGATGCAGTTTCCCCAGGG - Intergenic
1026924753 7:74182939-74182961 CAATGAGAACAGTTTCACCAGGG - Intronic
1028930580 7:96408835-96408857 AAAGTGGGACAGTTTACCCATGG + Intergenic
1030636439 7:111954482-111954504 CAACTGAAAGATTCTCCCCAGGG + Intronic
1043821876 8:84876590-84876612 CAATGGGAACAGTTACTCCATGG + Intronic
1047381310 8:124366355-124366377 CAACTGGAACTGTTGACCCAAGG - Intronic
1047567624 8:126062819-126062841 CCCCTGGAACATTTGCCCCAGGG - Intergenic
1048884051 8:138894368-138894390 CAGCTGGACCACTTTGCCCATGG - Intronic
1052378658 9:27745647-27745669 CAAAGAGAACAGTTTGCCCAAGG + Intergenic
1053917411 9:42953924-42953946 TTACTGGAACAGCTTCTCCATGG - Intergenic
1055118592 9:72632465-72632487 AAACTTGAGAAGTTTCCCCAGGG + Intronic
1055159021 9:73101716-73101738 CAAATGCAACAGTATCCCCAGGG - Intergenic
1056797445 9:89668441-89668463 CAACTGCTTCAGTTTCCTCATGG + Intergenic
1058282045 9:103127847-103127869 CAACTGCAACAGGGTGCCCATGG + Intergenic
1058869797 9:109191929-109191951 CAACAGCAAGAGATTCCCCACGG + Intronic
1203793862 EBV:165810-165832 CACCTGGAACTATTTTCCCACGG - Intergenic
1186864973 X:13711092-13711114 CAACTAGGAAACTTTCCCCAAGG - Intergenic
1188800938 X:34528694-34528716 CAACTGGCAAAATCTCCCCAGGG + Intergenic
1189147551 X:38670901-38670923 CAATTGGAACAGTTTCAAAATGG + Intronic
1190161480 X:48034614-48034636 GCCCTAGAACAGTTTCCCCAAGG + Intronic
1190387185 X:49893648-49893670 CAAATGGCAAAGTTTACCCAAGG + Intergenic
1190568766 X:51760441-51760463 GTCCTGGAACCGTTTCCCCATGG - Intergenic
1191885773 X:65886448-65886470 GAACTGAAATAGTTTGCCCAAGG - Intergenic
1196141760 X:112270560-112270582 CAACTGGAACCATTGCCCCAAGG - Intergenic
1198073509 X:133172468-133172490 CCACTGAAACATTGTCCCCAGGG - Intergenic
1198676943 X:139141132-139141154 CAATTGGCACCCTTTCCCCAAGG + Intronic
1201637999 Y:16146680-16146702 AAACTTTAACAATTTCCCCAAGG + Intergenic
1201786971 Y:17795145-17795167 CAACTAGGAAACTTTCCCCAAGG - Intergenic
1201814582 Y:18110843-18110865 CAACTAGGAAACTTTCCCCAAGG + Intergenic
1202300596 Y:23409571-23409593 CAAAAGGAACATGTTCCCCAGGG + Intergenic
1202570215 Y:26261027-26261049 CAAAAGGAACATGTTCCCCAGGG - Intergenic