ID: 1100179619

View in Genome Browser
Species Human (GRCh38)
Location 12:92071352-92071374
Sequence AAATTGCTACTGGTTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 127}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100179619_1100179622 9 Left 1100179619 12:92071352-92071374 CCTGGGGAAACCAGTAGCAATTT 0: 1
1: 0
2: 1
3: 15
4: 127
Right 1100179622 12:92071384-92071406 TTGCTCTACTGCTGGCATACAGG 0: 1
1: 0
2: 2
3: 5
4: 112
1100179619_1100179624 16 Left 1100179619 12:92071352-92071374 CCTGGGGAAACCAGTAGCAATTT 0: 1
1: 0
2: 1
3: 15
4: 127
Right 1100179624 12:92071391-92071413 ACTGCTGGCATACAGGAGGTTGG 0: 1
1: 0
2: 0
3: 15
4: 165
1100179619_1100179621 1 Left 1100179619 12:92071352-92071374 CCTGGGGAAACCAGTAGCAATTT 0: 1
1: 0
2: 1
3: 15
4: 127
Right 1100179621 12:92071376-92071398 TCTTGTTCTTGCTCTACTGCTGG 0: 1
1: 0
2: 0
3: 21
4: 250
1100179619_1100179623 12 Left 1100179619 12:92071352-92071374 CCTGGGGAAACCAGTAGCAATTT 0: 1
1: 0
2: 1
3: 15
4: 127
Right 1100179623 12:92071387-92071409 CTCTACTGCTGGCATACAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 133
1100179619_1100179625 17 Left 1100179619 12:92071352-92071374 CCTGGGGAAACCAGTAGCAATTT 0: 1
1: 0
2: 1
3: 15
4: 127
Right 1100179625 12:92071392-92071414 CTGCTGGCATACAGGAGGTTGGG 0: 1
1: 0
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100179619 Original CRISPR AAATTGCTACTGGTTTCCCC AGG (reversed) Intronic
902090716 1:13901010-13901032 AAGTTGCTACTTGTTTTCCTTGG + Intergenic
904199021 1:28807279-28807301 AAATTGTTAATAGCTTCCCCAGG + Intergenic
905264868 1:36744817-36744839 ACATTTCTAATGGTTTCCCTAGG + Intergenic
909175032 1:72346704-72346726 AAATTGCTTCTGGTTCCTCTAGG + Intergenic
911360858 1:96873897-96873919 AAATTGCCACAGGGTTGCCCAGG + Intergenic
913387690 1:118277751-118277773 CTAGTGCTTCTGGTTTCCCCAGG + Intergenic
923452791 1:234135586-234135608 AACTTGCACCTGGTTTCCTCTGG - Intronic
1067514000 10:46920989-46921011 AAATTGGTAGTGGTTTCGACTGG - Intronic
1067648254 10:48130843-48130865 AAATTGGTAGTGGTTTCGACTGG + Intergenic
1068959924 10:62856552-62856574 AAATAGCCACTTGTTGCCCCTGG - Intronic
1070247219 10:74743871-74743893 AAGTTGCAAGTGGCTTCCCCGGG + Intergenic
1071668555 10:87585301-87585323 AAATTGCTACTGGGTTATCATGG - Intergenic
1075769210 10:124918637-124918659 AAATTCCTTATGGTTTCCCCTGG - Intergenic
1078415026 11:11157805-11157827 GAATGGCTCCTGGTTTCTCCAGG + Intergenic
1078431846 11:11294171-11294193 AACTTGGACCTGGTTTCCCCAGG - Intronic
1085594450 11:77795894-77795916 AACTTGTTATTGGTTTCCTCAGG + Intronic
1090756642 11:129797727-129797749 AAATTGGTAGTGGTTTCAACTGG + Intergenic
1095976798 12:47945879-47945901 AAATTTCGCCTGGTTTCCCAGGG + Intergenic
1096035073 12:48459753-48459775 AACTTGCACCTGGTTTCTCCTGG - Intergenic
1097839135 12:64304158-64304180 CAAGTGATACTGGTTTTCCCTGG - Intronic
1098916796 12:76265408-76265430 ATATTGGTACTGTTTTCCCATGG - Intergenic
1100179619 12:92071352-92071374 AAATTGCTACTGGTTTCCCCAGG - Intronic
1103881103 12:124166650-124166672 ACATTTCTCCTGGTTTGCCCAGG - Intronic
1104351663 12:128049385-128049407 AGGTTGCTACTAGTTTCCTCTGG - Intergenic
1105914854 13:24904228-24904250 AAATTCCCACTGATTTCCTCAGG - Intronic
1107016806 13:35714218-35714240 AAATAGCTCCTGCTGTCCCCGGG + Intergenic
1110687303 13:78390007-78390029 AAATTGCTTCTTGTCTCCACAGG - Intergenic
1112052580 13:95657754-95657776 AAATAGCTATTGGTTTATCCAGG + Intergenic
1112636002 13:101218785-101218807 AAGTTTCTTGTGGTTTCCCCAGG + Intronic
1113694650 13:112335806-112335828 AAAATGCTACATGTTTCCTCAGG - Intergenic
1116512996 14:45769815-45769837 AATTTGACACTGGTTTCCCATGG - Intergenic
1117013870 14:51498516-51498538 TAATTGCTACTGGTATTACCTGG + Intronic
1117613632 14:57509603-57509625 AAATAGCTACTGATATTCCCAGG - Intergenic
1120935306 14:89889863-89889885 AACTGGCATCTGGTTTCCCCTGG + Intronic
1124634890 15:31358973-31358995 AAGATGCTTCTGGCTTCCCCTGG + Intronic
1124653876 15:31492634-31492656 TAATTGTTAGTGGTTTCCCTAGG - Intronic
1126882895 15:53118094-53118116 CAATTCCTCCTGGTTTCCCTGGG + Intergenic
1127138738 15:55952469-55952491 AAATTTCTCCTGTTTTCCTCGGG + Intronic
1128131512 15:65230296-65230318 TATTTCCTACTGGTTTCTCCCGG - Intergenic
1130708908 15:86260186-86260208 CAAATGCTGCTGGTTTCCCCAGG - Intronic
1130720912 15:86385559-86385581 AAATACCTATTGGTTTCCCATGG + Intronic
1130860198 15:87878970-87878992 AAATTGTTACTGTTTTCGCAGGG - Intronic
1131555980 15:93399355-93399377 ACATTGCTACATGTTCCCCCAGG + Intergenic
1132044581 15:98552505-98552527 AAATTGCTAATGGCTTCCCAGGG + Intergenic
1132274283 15:100553443-100553465 ACATTGCTACTGGTCTGCTCAGG + Intergenic
1132654922 16:1037750-1037772 ACATGGCTGCTGGCTTCCCCAGG - Intergenic
1134309678 16:13064298-13064320 AATTTGCTGCTGGTATCTCCAGG - Intronic
1138366788 16:56485738-56485760 AAATTTCTACTGATTTGCACAGG - Exonic
1140733604 16:77878283-77878305 AACTGGCTACTAGTTTACCCAGG + Intronic
1149254047 17:54804569-54804591 CAATTGCTATTGTTTTCCCAGGG - Intergenic
1150576041 17:66431902-66431924 AAATTATTACTGGTTTTCCATGG - Intronic
1150944808 17:69733467-69733489 AAAGTTCTACTGTTTACCCCAGG - Intergenic
1151055443 17:71025916-71025938 AAATAGCTACCGGCTGCCCCAGG + Intergenic
1152115596 17:78385091-78385113 AAATGCCTTCTGTTTTCCCCAGG + Intronic
1156488707 18:37483684-37483706 AATGTGCTCCTGATTTCCCCTGG + Intronic
1158725036 18:59963486-59963508 AAAATGCTAGTTGTTTCCCTCGG - Intergenic
1160431460 18:78815860-78815882 AAATTCCTTCTGGTTCCCTCAGG - Intergenic
1161887052 19:7005194-7005216 AAAGCGCTCCTGGTGTCCCCGGG - Intergenic
1164860695 19:31560145-31560167 AAAATGCTTCTCTTTTCCCCTGG + Intergenic
936262363 2:110972720-110972742 AACTTGCTTCTGGTTTCCTCTGG - Intronic
936896857 2:117437562-117437584 TAATTGCTACTGGCTGCCCAGGG + Intergenic
937474208 2:122200436-122200458 AAATCGCTGCATGTTTCCCCAGG + Intergenic
938599358 2:132821498-132821520 AAATTGGTAGTGGTTTCAACTGG + Intronic
939563481 2:143759099-143759121 AAATTGCTACTGGTGTCTAATGG - Intronic
941125904 2:161582745-161582767 AAAAGGCTACTGGTTTTCTCAGG - Intronic
943088248 2:183342153-183342175 AATTTTATACTGGTTTCACCTGG - Intergenic
945497391 2:210525733-210525755 AAATTTCTACTTGTTTCCTAAGG - Intronic
945809661 2:214533400-214533422 AAATTGCAGCTGGTCTTCCCAGG + Intronic
945984678 2:216344042-216344064 ACATTGCTAATGGTTTTGCCAGG - Intronic
946174988 2:217917081-217917103 AACTTTCTCCCGGTTTCCCCTGG + Intronic
947762334 2:232611762-232611784 AGATGGCTCCTGGTGTCCCCTGG - Intronic
1174179517 20:48666091-48666113 AAATGGCTTCTGGTGTCCACTGG - Intronic
1174911086 20:54608288-54608310 AAGTGGCCACTGGTTTCCCCTGG - Intronic
949504019 3:4709888-4709910 ACATTACTACTGGTTTTCTCTGG - Intronic
953661221 3:44893359-44893381 AAATTGCTCCAGATTTTCCCAGG + Intronic
955197672 3:56820200-56820222 CAGTTGCTACTGGCCTCCCCTGG - Intronic
958626534 3:96632117-96632139 AAGGTATTACTGGTTTCCCCAGG + Intergenic
960303311 3:116030892-116030914 TAAATCCTACTGGCTTCCCCTGG - Intronic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
963959220 3:151289756-151289778 AAATAGATACTAGGTTCCCCAGG - Intronic
966194126 3:177297060-177297082 TAATTGCTACTTGTTCTCCCTGG - Intergenic
970280541 4:14449908-14449930 AAGTGGCAACTGGATTCCCCAGG - Intergenic
972010311 4:34171376-34171398 AAATGGATACTGATTTCCCCAGG - Intergenic
976035979 4:80821586-80821608 AAATTGCTACTTGTTTGACTTGG - Intronic
982340446 4:154292841-154292863 AAATGGCTACTGGTTCACCTGGG - Intronic
983093604 4:163536756-163536778 AAATGGCAACTGTTTCCCCCTGG - Intronic
983106832 4:163697054-163697076 AGCTTGCTCCTGGTTTCCTCTGG - Intronic
984581459 4:181515194-181515216 GAATTGCCTCTGCTTTCCCCCGG + Intergenic
986507957 5:8472355-8472377 AACTTGCTCCTGGTTTCCTCTGG + Intergenic
987137915 5:14917028-14917050 AACTTGTCTCTGGTTTCCCCTGG - Intergenic
987238944 5:15972843-15972865 AAATTGGAATTGGATTCCCCAGG - Intergenic
987722112 5:21650328-21650350 AAATTTTTACTTTTTTCCCCTGG - Intergenic
993610691 5:90050475-90050497 AGCTTGCAACTGGTTTCCCCTGG + Intergenic
994141909 5:96350892-96350914 AAATGGCTCTTGATTTCCCCTGG + Intergenic
995852843 5:116564032-116564054 TAATTGCTACTGGTTTCACCGGG - Intronic
1001228110 5:169963069-169963091 AAATATCTACTGGGTTCCCCTGG + Intronic
1003734461 6:8862816-8862838 AAATTTCTACCAGTTTCCTCAGG + Intergenic
1007842855 6:44730846-44730868 GAATTGCTACTGCATTCCACAGG - Intergenic
1009441170 6:63680363-63680385 GAGTTACTAGTGGTTTCCCCTGG - Intronic
1009779885 6:68256181-68256203 AAATTGGTAGTAGTTTCCACTGG - Intergenic
1010260356 6:73808401-73808423 ACAATGCTTCTGGTCTCCCCAGG + Intronic
1013050632 6:106531433-106531455 TAATTTCTACTGGTTTTTCCTGG - Intronic
1015417699 6:132968529-132968551 AAATTGCTACTGGCATCTACTGG + Intergenic
1016634965 6:146277626-146277648 ACCTTGCTCCTGGTTTCCCCTGG + Intronic
1017927537 6:158923193-158923215 AAATTGTTTCTGGTTTCTCTGGG + Intergenic
1018637583 6:165877392-165877414 ACATTACTACTGCTTTCCTCTGG + Intronic
1019618049 7:1975429-1975451 AAAGTGGAACTGGTTTTCCCTGG - Intronic
1022349631 7:29555538-29555560 AAATTGCCACTGCTTACCTCTGG + Intergenic
1025000332 7:55310592-55310614 AAAATGCTAATGATTTCCCAGGG - Intergenic
1027548778 7:79564216-79564238 AAACTGCTACTGGTGCCCCTGGG - Intergenic
1027974926 7:85140721-85140743 AAGTTTCTTCTGGTTTCCCTGGG + Intronic
1030120209 7:106102448-106102470 ACATGGCCACTGGCTTCCCCCGG - Intronic
1030964650 7:115975958-115975980 AAATTTCTACTGGATACCACTGG - Intronic
1032694273 7:134320366-134320388 AAATGGTAACTTGTTTCCCCTGG + Intergenic
1034543110 7:151772132-151772154 AGATTGCTACTACTTTACCCAGG + Intronic
1035293832 7:157856549-157856571 ACAGTTCTACTGGTTTCTCCTGG + Intronic
1036222674 8:6933911-6933933 AAATTGCAACTAGTTCCCCCTGG - Intergenic
1036224776 8:6948700-6948722 AAATTGCAACAAGTTCCCCCTGG - Intergenic
1036226866 8:6966689-6966711 AAATTGCAACTAGTTCCCCCTGG - Intergenic
1037043092 8:14262177-14262199 AAATTGCTAATGGTTTTACTTGG - Intronic
1037623235 8:20585441-20585463 AACTTGTAACTGGTTTCTCCAGG + Intergenic
1037660801 8:20925101-20925123 ATGTTGTTACTGGTTTCCCAGGG + Intergenic
1038032512 8:23655046-23655068 AAATTGTTGCTAGTTTACCCTGG + Intergenic
1038338294 8:26662776-26662798 ATATTGTTACTTTTTTCCCCAGG + Intergenic
1046904130 8:119554161-119554183 AATTTGCAACCGGTTTCCCCAGG + Intergenic
1047962317 8:130019461-130019483 GAATTGCCAGAGGTTTCCCCGGG - Intergenic
1049919036 9:346234-346256 AAAATGCTAGTGGTTTGCCTAGG + Intronic
1051728141 9:20109651-20109673 AACTTGCTCCTGGTTTCCTCTGG + Intergenic
1054755560 9:68954031-68954053 CAATTGCTTCTGGTGTCCCTGGG + Intronic
1056507916 9:87275141-87275163 AACTTGCTACTGGGTTGGCCAGG - Intergenic
1057926488 9:99155819-99155841 AAATAGCATGTGGTTTCCCCTGG - Intergenic
1058805915 9:108591661-108591683 AAATTTCTAATGGTTTCTCCCGG + Intergenic
1186247384 X:7628687-7628709 ATATTTCTTCTGTTTTCCCCTGG - Intergenic
1187356418 X:18576862-18576884 AAAGAGCATCTGGTTTCCCCTGG - Intronic
1187511120 X:19920250-19920272 AACTTGCACCTGGTTTCCTCTGG + Intronic
1187854706 X:23625584-23625606 AAATTGAAACAGTTTTCCCCTGG - Intergenic
1188322102 X:28752504-28752526 AAACTGCTAGTGGTTTCCTGTGG - Intronic
1193739461 X:85200812-85200834 AAATTGCTAATGGTATTACCTGG - Intergenic
1194370827 X:93069553-93069575 ATATTACTACTGGTTTCTCAGGG - Intergenic
1195558631 X:106257194-106257216 ACAGTTCTACTGCTTTCCCCTGG - Intergenic
1197130330 X:122998103-122998125 AAAGTTCTGCTGGTTTCTCCTGG - Intergenic
1197354472 X:125419950-125419972 AACTTTTTAATGGTTTCCCCAGG - Intergenic
1199353283 X:146830899-146830921 AAATTGCTTATGGTTTCCAGAGG + Intergenic
1200678623 Y:6181445-6181467 ATATTACTACTGGTTTCTCAGGG - Intergenic