ID: 1100181686

View in Genome Browser
Species Human (GRCh38)
Location 12:92093075-92093097
Sequence GGTTTGCTTGTTTTTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5779
Summary {0: 1, 1: 33, 2: 611, 3: 1152, 4: 3982}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100181686 Original CRISPR GGTTTGCTTGTTTTTGAGAC AGG Intronic
Too many off-targets to display for this crispr