ID: 1100184497

View in Genome Browser
Species Human (GRCh38)
Location 12:92124788-92124810
Sequence ATGAGTTTAGGGAAGGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 370}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100184497 Original CRISPR ATGAGTTTAGGGAAGGAAGC CGG (reversed) Intronic
900035297 1:402694-402716 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900056918 1:638447-638469 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
901267590 1:7923489-7923511 ATCACTCTAGGGAAGGAAGGAGG - Intronic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
904625296 1:31798918-31798940 ATGTGTGGAGGGGAGGAAGCCGG + Intronic
904677672 1:32208244-32208266 ATGAGTATAGGGAAGGAGGAAGG + Exonic
904772029 1:32886120-32886142 GTGGGTATGGGGAAGGAAGCGGG + Intronic
905172702 1:36118558-36118580 AGGGGATTAGGGAAGGCAGCTGG - Intronic
905308657 1:37035021-37035043 ATGGGGTTGGGGAGGGAAGCCGG - Intergenic
906869010 1:49455777-49455799 ATGAGCAAAGGGAAGGTAGCAGG - Intronic
906905565 1:49887078-49887100 AGGAGTATAGGCAAGGAAGGTGG + Intronic
907459538 1:54597226-54597248 ATGGGATAAGGGAGGGAAGCAGG - Intronic
907604814 1:55805925-55805947 ATGAGTTTAGAAAAGGTAGCAGG + Intergenic
908768423 1:67574301-67574323 ATGAGTTTAAGAGACGAAGCTGG - Intergenic
909135658 1:71796841-71796863 AGGAGTTGAGAGAAGGAAGTTGG + Intronic
910310282 1:85815864-85815886 ATGACATTAGGGAAGGAAAGCGG + Intronic
911168519 1:94746207-94746229 CAGAGTCTAGGGAAGTAAGCAGG - Intergenic
911709349 1:101052056-101052078 TATAGTTTAGAGAAGGAAGCAGG - Intergenic
912320464 1:108707904-108707926 ATGAGCTTAGTGAAGGAGGGTGG + Intergenic
912580281 1:110714735-110714757 ATGAGTAGGGGGAAGGGAGCGGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913516950 1:119612968-119612990 CTGAGGTCAGTGAAGGAAGCAGG - Intergenic
913530739 1:119732637-119732659 ATGACTGCAGGGAAGGAATCTGG - Intronic
914404427 1:147357208-147357230 AGTTGTTTAGGAAAGGAAGCTGG - Intergenic
914426901 1:147586164-147586186 ATGACTTTAGGGAGCTAAGCTGG - Intronic
914684504 1:149966332-149966354 CTGAGTGGAGGGAAGGAATCAGG - Intronic
914688992 1:150009184-150009206 AAGACTTCAGGGACGGAAGCTGG - Intronic
915246736 1:154560848-154560870 ATGAGTCCAGTGAAGAAAGCAGG + Intergenic
917835870 1:178941323-178941345 ATGGGTTTAGGGAAGGTAGGAGG - Intergenic
918270005 1:182889235-182889257 ACGAGTTTAGGGAGGACAGCTGG - Intergenic
918552623 1:185761042-185761064 ATGAGTTTAGGACAAGGAGCTGG + Intronic
919620667 1:199861265-199861287 AGGAGTAGAGGGAAGGAAACAGG - Intergenic
921230617 1:213066616-213066638 ATGAGTATTGCTAAGGAAGCCGG + Intronic
921250373 1:213291811-213291833 ACGTGTTTAAGAAAGGAAGCTGG - Intergenic
922257827 1:223908254-223908276 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
922272766 1:224049441-224049463 TTGCTTCTAGGGAAGGAAGCTGG + Intergenic
923279540 1:232429850-232429872 ATGTGTTTTGGGAAAGATGCGGG + Intronic
924339025 1:243011033-243011055 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1064601653 10:16999858-16999880 AGGAGGTGAGGGAAGGAATCAGG - Intronic
1067916063 10:50400042-50400064 AAGAGTTCAAGGAAGGAATCTGG + Intronic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1068465902 10:57391217-57391239 ATGAGCTTCTGGAAGGAAGGGGG - Intergenic
1068586230 10:58802140-58802162 ATAAGTAAAGGAAAGGAAGCAGG - Intronic
1068829011 10:61471588-61471610 TTGAGTTTAGAAAAGAAAGCAGG + Intergenic
1069133935 10:64740692-64740714 ATGAGAAAAGGGAAGGATGCCGG - Intergenic
1069250915 10:66265802-66265824 ATGAGTGATAGGAAGGAAGCAGG - Intronic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1070276584 10:75013060-75013082 ATGTCTTTGGGGAAGGAGGCTGG - Intronic
1070377087 10:75843186-75843208 ATGAGTTCAGGGAAGAAATAAGG + Intronic
1071393749 10:85201005-85201027 ATGAATGTAGTGAAGGAAGCTGG - Intergenic
1071876094 10:89844842-89844864 ATAGATTCAGGGAAGGAAGCAGG + Intergenic
1071986478 10:91056056-91056078 ATGAGTGTGGGGTAGGAAGAGGG + Intergenic
1074666265 10:115729571-115729593 ATCAGTTTATGGACAGAAGCTGG - Intronic
1076444571 10:130503846-130503868 ATGAGGTTGGGGATGGAAGTAGG - Intergenic
1077059327 11:610827-610849 CTGAGTTTATGGGCGGAAGCTGG + Intronic
1077143039 11:1033268-1033290 ACGAGAGCAGGGAAGGAAGCTGG - Intronic
1077808528 11:5613675-5613697 ATGAGTTTACAGAAGAGAGCTGG - Intronic
1078087784 11:8244534-8244556 ATTAGTTTGGGGAAGAAAGGAGG + Intronic
1078575056 11:12494302-12494324 ATGAGAAAGGGGAAGGAAGCTGG - Intronic
1078776411 11:14397822-14397844 ATGTTTTCAGGGAAGAAAGCTGG + Intergenic
1081086013 11:38802256-38802278 TGGAGTATAGGGAAGAAAGCAGG - Intergenic
1081481767 11:43496207-43496229 ATATGTTGAGGGAAAGAAGCCGG - Intergenic
1082912117 11:58389465-58389487 ATTAGTTTAGGAAAGGTAGGTGG + Intergenic
1084566699 11:69932670-69932692 AGGATTTTGGGGGAGGAAGCAGG + Intergenic
1084575292 11:69985113-69985135 ATGGGCTCAGGGCAGGAAGCCGG - Intergenic
1084800230 11:71538832-71538854 ATGAGGTCAGGAAAGGAAGAGGG - Exonic
1085295046 11:75426731-75426753 AAGGGTTAAGGGAAGGCAGCAGG + Intronic
1085679419 11:78558175-78558197 ATGAGTTCAAAGAAGGCAGCAGG - Intronic
1086181575 11:83957682-83957704 ATTAGGTTAGATAAGGAAGCAGG - Intronic
1088368206 11:109061011-109061033 ATGAATTTAGGGAAAGAGGAGGG - Intergenic
1088456070 11:110034279-110034301 ATGAGGTCAGAGAAGGAAGCAGG - Intergenic
1088740504 11:112763215-112763237 CTGAGGTTTGGAAAGGAAGCAGG - Intergenic
1089022154 11:115227434-115227456 AAGAGTTTAGGGGTGGAAACTGG + Intronic
1089894085 11:121909872-121909894 ATGAAGTTAGAGAAGAAAGCTGG - Intergenic
1091058537 11:132440999-132441021 ATGAGTTAAAGGAAGGAAAACGG + Intronic
1091812998 12:3415402-3415424 ATGACTCTAGGGAAGGGAGAGGG - Intronic
1091852557 12:3712081-3712103 ATGAGAATAGGGAAGGCAGAGGG - Intronic
1093288378 12:17294672-17294694 ATGAGGGTAGGGAAGGAGGTAGG - Intergenic
1095625520 12:44309545-44309567 AGGAGTTGAGGGAGGGAAGAAGG + Intronic
1095713508 12:45315954-45315976 ATGAGTCCAGGGAAGAAAGGTGG - Intronic
1095810056 12:46364337-46364359 AAGAGTTTAGGGAAGAAAAGAGG - Intronic
1096289654 12:50331029-50331051 AGGAGCTTTGGGAAGGAAGGGGG - Intronic
1096770909 12:53935448-53935470 GTGAGTTTAGGGATGGGTGCAGG - Intergenic
1096871706 12:54596656-54596678 ATGAGTCCAAGGAGGGAAGCAGG - Intergenic
1097158158 12:57027505-57027527 GTGAGTTAAGGGAAGGAAGCGGG + Intronic
1097927663 12:65147812-65147834 GTGAGTTTAGGGTAAGAAACAGG + Intergenic
1097998557 12:65916797-65916819 AAGAATTGAGGGAAGGATGCAGG + Intronic
1098056618 12:66513305-66513327 ATGAAGTTAGAAAAGGAAGCAGG - Intronic
1099699880 12:86069986-86070008 ATGAGTTCAAGGAAGGCACCAGG - Intronic
1100083878 12:90883532-90883554 ATGGGTTTAGGGGAGGAATACGG - Intergenic
1100184497 12:92124788-92124810 ATGAGTTTAGGGAAGGAAGCCGG - Intronic
1100381966 12:94070756-94070778 ATGAGATCAAGGAAGGAAGGAGG + Intergenic
1100591047 12:96029943-96029965 TGGAGTTTAAGGAAGGAAGGAGG - Intronic
1101037466 12:100719229-100719251 ATCATTTTAGGGATGGATGCAGG - Intronic
1101141129 12:101797189-101797211 ATGGGTCTAGGAAAGAAAGCTGG + Intronic
1101406429 12:104433132-104433154 GTGTTTTTAGGGAAGGAAGGCGG - Intergenic
1101722501 12:107362345-107362367 ATGAGTTTGGGAAGAGAAGCTGG - Intronic
1104487095 12:129161124-129161146 ACAGGTTTGGGGAAGGAAGCAGG - Intronic
1104916422 12:132267189-132267211 ATGAGGGCAGGGAAGGAGGCAGG + Intronic
1107237697 13:38192753-38192775 ATGAGGTCAGGGAAGGAGGGCGG - Intergenic
1108793470 13:54001696-54001718 ATGAGTTTAGAGGAGGAGGCTGG - Intergenic
1109383770 13:61600523-61600545 ATCAGTTTAGGGATGAAAACTGG + Intergenic
1111066487 13:83100385-83100407 ATGAGTTTAAGGCATGAGGCTGG + Intergenic
1111617287 13:90676098-90676120 AAGAGGGTAGGGGAGGAAGCAGG + Intergenic
1112424882 13:99289236-99289258 ATAAGTTGAGGAAAGGAAGATGG + Intronic
1112961231 13:105129345-105129367 ATGAGATAAAGGAATGAAGCAGG + Intergenic
1114416525 14:22548516-22548538 ATGAGTTGAATGAAGGAGGCAGG + Intergenic
1115006477 14:28491685-28491707 ATGAATTTTGGGAAGGGGGCAGG - Intergenic
1116721742 14:48505025-48505047 ATGAGTTGAGGGAATGGTGCTGG - Intergenic
1116751902 14:48896902-48896924 ATGAGCCTAGGGAAGTAAGCAGG + Intergenic
1117387564 14:55231334-55231356 ATGAGTTTGGAGAAGATAGCGGG + Intergenic
1118004297 14:61551973-61551995 ATGAGTTTTGTGAATGAAACAGG - Intronic
1118645492 14:67834525-67834547 ATGAGGCTAGAGAAGTAAGCAGG - Intronic
1119517160 14:75257378-75257400 AAGTGTTTAGGGAAGGATGTCGG + Intronic
1120939537 14:89934057-89934079 ATGAGGTTGGGGAGGGCAGCAGG + Intronic
1123198785 14:106641867-106641889 ATGAGATTTGGGAGGGAACCTGG + Intergenic
1124091707 15:26610320-26610342 ATGAGTGTTGGCAAGGAAGAAGG - Intronic
1125379868 15:39076175-39076197 ATGAGGTTACTGAAGAAAGCAGG - Intergenic
1126515119 15:49525106-49525128 ATGAGATTTGGGAGGGAATCGGG + Intronic
1127598678 15:60513026-60513048 AAGAGTCTAGGGCAGGAGGCAGG + Intronic
1128712773 15:69884645-69884667 AGGAGCTTAGGGAAGGGAGTTGG + Intergenic
1130262295 15:82365291-82365313 AAGAGATTTAGGAAGGAAGCGGG - Intergenic
1130278933 15:82503716-82503738 AAGAGATTTAGGAAGGAAGCGGG + Intergenic
1130623201 15:85485539-85485561 AAGAGATTTAGGAAGGAAGCGGG - Intronic
1131434499 15:92412265-92412287 ATGAGAGGAGGGAAGGAAGGGGG + Intronic
1131888761 15:96949286-96949308 ATGTGTTTGGGGAAGGAATGTGG + Intergenic
1133629209 16:7603184-7603206 TAGAGTCTATGGAAGGAAGCAGG + Intronic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1134353424 16:13459367-13459389 ATGACTTGAGGGGAGGAAGGTGG - Intergenic
1134467496 16:14492327-14492349 ATGAATCAAGGAAAGGAAGCAGG + Intronic
1135559310 16:23463297-23463319 ATGAGCTCAGGGAAGAGAGCGGG + Intergenic
1135643938 16:24145039-24145061 ATGAGTTTAGAGAAGGTGGTAGG + Intronic
1136720401 16:32315272-32315294 GTGAGGTTAGGAAAGGAAGTAGG + Intergenic
1136838778 16:33521546-33521568 GTGAGGTTAGGAAAGGAAGTAGG + Intergenic
1136849902 16:33604295-33604317 ATGAGTGCAGGGAAGGAACAAGG - Intergenic
1137784288 16:51125166-51125188 ATTTGATGAGGGAAGGAAGCAGG + Intergenic
1137790985 16:51174568-51174590 ATGAGTTTGGAGAGGGAGGCTGG - Intergenic
1139186537 16:64812405-64812427 ATGAGTTTAGGTAAGGAAGTTGG + Intergenic
1139425732 16:66878966-66878988 AAGACTTTAGGGCAGGAGGCCGG + Intronic
1140256623 16:73342540-73342562 ATGTGTTGAGGGAAGAAAACGGG + Intergenic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1203006031 16_KI270728v1_random:202497-202519 GTGAGGTTAGGAAAGGAAGTAGG - Intergenic
1203111513 16_KI270728v1_random:1452748-1452770 ATGAGTGCAGGGAAGGAACAAGG - Intergenic
1203148943 16_KI270728v1_random:1821834-1821856 GTGAGGTTAGGAAAGGAAGTAGG + Intergenic
1143924990 17:10361738-10361760 CTGAGTTTGGGGAAGAACGCAGG + Intronic
1146438477 17:32873300-32873322 ATGACTTAAAGGAAGGAAGCAGG + Intronic
1146704745 17:34992800-34992822 AGAAGTTTAGGGAAGGAAGAGGG + Intronic
1146901797 17:36593454-36593476 TTGAGTCTAGAGGAGGAAGCGGG + Intronic
1147170232 17:38614214-38614236 ATGTGTGTAAGGAAGGAAGGGGG - Intergenic
1147217512 17:38909221-38909243 ATGAGGATGGGGGAGGAAGCGGG - Intronic
1149338500 17:55662627-55662649 ATGGGTGAAGGGAAGGAAGGAGG - Intergenic
1150494234 17:65594848-65594870 CTGAGTTTAAGGGAGGCAGCCGG + Intronic
1151329184 17:73396775-73396797 GTGAGATTCAGGAAGGAAGCAGG + Intronic
1152195490 17:78915923-78915945 ATGAGGATAGGGAAGGAAATGGG + Intronic
1153603556 18:6807841-6807863 CTGAGTTTAGGAAATGGAGCTGG - Intronic
1156600097 18:38595608-38595630 AAGAGTTTTGGGGAGAAAGCAGG + Intergenic
1158152514 18:54388477-54388499 AAGAGCTTGGTGAAGGAAGCTGG - Intergenic
1161258603 19:3323267-3323289 AGGAGATTTGGGGAGGAAGCAGG + Intergenic
1161934597 19:7363896-7363918 ATGGGTTGATGGAAGGAAGGAGG + Intronic
1161934655 19:7364241-7364263 ATGGGTTGATGGAAGGAAGGAGG + Intronic
1164770009 19:30801385-30801407 ACCAGTCCAGGGAAGGAAGCTGG - Intergenic
1164940170 19:32246133-32246155 TTAAGTTTAGTGAAGAAAGCAGG + Intergenic
1166439294 19:42797294-42797316 ATGAGATTTGGGAGGGAAGATGG - Intronic
1166443654 19:42839175-42839197 AGGAGTTTAGTGGAGGAAGGAGG + Intronic
1166469494 19:43066397-43066419 AGGAGTTTAGTGGAGGAAGGAGG + Intronic
1166480625 19:43169935-43169957 AGGAGTTTAGTGGAGGAAGGAGG + Intronic
1166483041 19:43188871-43188893 ATCAGTTTAAGGAAAGCAGCTGG - Intronic
1166494923 19:43293617-43293639 ATGAGATTTGGGAGGGAAGATGG - Intergenic
1166956310 19:46467845-46467867 GTGATTATAGGGAAGGACGCAGG - Exonic
1168527268 19:57099240-57099262 ATGAACTTAGGGAGGGAGGCAGG - Intergenic
925509862 2:4613336-4613358 ATGAATTTAGGGATGGGGGCAGG + Intergenic
925930774 2:8706118-8706140 AATAATTTAGGGAAGGAGGCGGG + Intergenic
926666098 2:15524926-15524948 GTGGGTTGAGGGAAGGAAACAGG - Intronic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
928777265 2:34780727-34780749 ATGTGTTTTGGGAAGGACCCAGG - Intergenic
929252369 2:39773021-39773043 ATGACATTATGGGAGGAAGCAGG + Intronic
931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG + Intronic
931578058 2:63741102-63741124 CTGCCTTTAGGGAAGGAAGCTGG + Intronic
931607158 2:64064152-64064174 AGGAGTTAAAGAAAGGAAGCTGG + Intergenic
931738257 2:65218184-65218206 ATGTGCTGAGGGAAAGAAGCTGG - Intergenic
932714160 2:74089622-74089644 ATGGGTTTACGGAAGTAAGGGGG - Intronic
932882447 2:75516454-75516476 ATGAGTATGGGGCAGGAAGGAGG + Intronic
933521247 2:83377202-83377224 AGGAGTTAAGGGAAGGAAGGAGG - Intergenic
933996521 2:87674118-87674140 AAGAGGTTCGGGAAGGAAGCCGG + Intergenic
934064616 2:88329484-88329506 ATGGGTACAGGGAGGGAAGCAGG - Intergenic
934902444 2:98171541-98171563 ATGAGTCTGGAGAGGGAAGCAGG + Intronic
935019709 2:99218052-99218074 ATGGGGTTGGGGAAGGAAGTGGG + Intronic
935507257 2:103920872-103920894 ATGAGTTAATGGAAGTAGGCAGG + Intergenic
935628890 2:105195660-105195682 AGGATTTTAGAGAAGGAGGCTGG + Intergenic
936297330 2:111276792-111276814 AAGAGGTTCGGGAAGGAAGCCGG - Intergenic
936844425 2:116813600-116813622 ATGACTTGAGGGAAGGATACAGG - Intergenic
936886490 2:117317306-117317328 GTGAATTTAGCAAAGGAAGCTGG - Intergenic
937879854 2:126857075-126857097 ATGACTGGAGGGAAGGAAGAAGG + Intergenic
938590261 2:132729004-132729026 ACAAGTTTAGGGAAGGAGGTGGG + Intronic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939220205 2:139291940-139291962 ATGAGGGTGGCGAAGGAAGCAGG + Intergenic
940667437 2:156625747-156625769 TTGAGTTCAAGGAAGGAAGTGGG - Intergenic
940677272 2:156739796-156739818 ATGAGATTAGGGATGGAATGAGG + Intergenic
941082436 2:161077690-161077712 ATGAGTTCAGGGAAAACAGCTGG + Intergenic
941357229 2:164509406-164509428 ATGAGTTCAGGGAAATTAGCTGG + Intronic
941818017 2:169817611-169817633 ATGAGTTCATGGGATGAAGCTGG + Intronic
942685524 2:178527055-178527077 CTGAGTTTAGGGAATGAATTTGG - Exonic
944315556 2:198281909-198281931 ATGAGGTTAGGAAAATAAGCAGG - Intronic
944380991 2:199110720-199110742 ATGAGGTCAGGGAAGGAGACAGG - Intergenic
946428359 2:219611861-219611883 ATGAGTTTGGGGAAGGGAAGGGG + Intronic
947053940 2:226078952-226078974 ATTAGTTTAGAGAAGACAGCAGG - Intergenic
947614380 2:231545732-231545754 ATGAGTTTACGGAAGGGTGTGGG + Intergenic
947639978 2:231701874-231701896 ATGAGCATAGGTAAGGAGGCTGG - Intergenic
948355891 2:237376702-237376724 ATGAGTTGAGGGTAGGCTGCTGG - Intronic
948388979 2:237598574-237598596 ATGAGGGTAGGGAAGGGGGCGGG - Intronic
948458011 2:238116258-238116280 AAGAGGGGAGGGAAGGAAGCTGG - Intronic
1168910003 20:1440110-1440132 ATGTGTCTGGGGTAGGAAGCGGG - Intergenic
1169004755 20:2197197-2197219 ATGAGGTTGGGGATGGAAGAGGG - Intergenic
1169265825 20:4166901-4166923 ATGATTTTAGGGAAGAAATGTGG + Intronic
1170486163 20:16818157-16818179 ATGAGTTTAGAGAAGTAAATGGG - Intergenic
1171052855 20:21876695-21876717 ATCAGTTTGGGAAAGGAAGCAGG + Intergenic
1171534408 20:25873487-25873509 ATGTGTTCAGGGAGGGAACCAGG + Intergenic
1172033173 20:31995624-31995646 ATCAGGTTGGGGAAGGAAGTGGG - Intronic
1173290724 20:41712685-41712707 CTGTGTTTAGGGAAGCAGGCTGG - Intergenic
1175372250 20:58499795-58499817 ATGGGGCTAGGGAGGGAAGCTGG - Intronic
1175633901 20:60564702-60564724 AGGAGCTCAGGGAAGGAAGTAGG + Intergenic
1176372487 21:6070725-6070747 AAGAGTTTTGAGAAGGAAGAGGG + Intergenic
1179337464 21:40471280-40471302 ACCACATTAGGGAAGGAAGCAGG + Intronic
1179750989 21:43467520-43467542 AAGAGTTTTGAGAAGGAAGAGGG - Intergenic
1181906646 22:26202514-26202536 GAGAGTTTTGGGGAGGAAGCTGG - Intronic
1183477075 22:38041555-38041577 ATGAGTTAACGTAAGGATGCAGG - Intronic
1183847176 22:40551866-40551888 ATGAATTTATGGAAGGAATAGGG + Intronic
1184636462 22:45836064-45836086 AACAATTTAGGGAAGGAAGAGGG + Intronic
1184878194 22:47288775-47288797 GTGAGTCTAGTGAAGGAGGCTGG + Intergenic
1185281103 22:49970248-49970270 ATGAGCTGAGGGGAGGAAGCAGG + Intergenic
1185355027 22:50363251-50363273 CTAAGTGTAAGGAAGGAAGCTGG - Intronic
949301619 3:2590598-2590620 ATGAGGTTAGAGAAGGCAGCAGG - Intronic
951062681 3:18228224-18228246 ATGAGTTTAGGGAAATGGGCAGG - Intronic
951700966 3:25496480-25496502 ATGAGTATCGGCAAGGAAGGTGG + Intronic
951905177 3:27699184-27699206 ATGAGATTGGAGAAGTAAGCAGG - Intergenic
952750166 3:36818396-36818418 AAGAAGTCAGGGAAGGAAGCAGG + Intergenic
954648390 3:52145104-52145126 ATGGGCTCAGGGAAGGGAGCTGG - Intronic
954990696 3:54838459-54838481 ATCAGTTTGGGGAAGGCACCAGG + Intronic
955021054 3:55121542-55121564 ATGAGTTTCAGAAAGGAAGGAGG + Intergenic
955763049 3:62309966-62309988 ATGAGTTTAGAGAAGTAAGCAGG + Intergenic
956078487 3:65532262-65532284 ATGAGGTCAGAGAAGAAAGCAGG - Intronic
956897990 3:73683421-73683443 ATGAGGTTAGGAAGAGAAGCAGG + Intergenic
957170094 3:76727384-76727406 ATGAATTTAGGGCAGCAAGTAGG - Intronic
958709884 3:97705133-97705155 ATGAGGCTAGAGAAGTAAGCAGG - Intronic
959107291 3:102079121-102079143 ATGAGTGGAGAGGAGGAAGCTGG - Intergenic
959145346 3:102537851-102537873 AAGAGTTTAGGGTATGAAGTGGG + Intergenic
959171832 3:102853450-102853472 ATGAATTTATGGAAGAAGGCAGG - Intergenic
960127716 3:114018677-114018699 ATGATCTTAGGGAAGAAAACAGG - Exonic
960179513 3:114558791-114558813 ATGTGTTCAGAGAAGGAATCAGG - Intronic
960783409 3:121345861-121345883 TTGGGATTAGGGAAGGAGGCAGG - Intronic
961107516 3:124254819-124254841 ATGAACTTTGGTAAGGAAGCAGG - Intronic
963026017 3:140919436-140919458 TTAGGTTTAGTGAAGGAAGCTGG - Intergenic
963285614 3:143431787-143431809 CTGAGTTTAGAGAAGTAAGAGGG - Intronic
964628180 3:158779462-158779484 ATGAGTTTAGTAAAAGAAACTGG + Intronic
964760492 3:160131033-160131055 AAGGGTCCAGGGAAGGAAGCAGG - Intergenic
965628892 3:170710412-170710434 GTGAGTTTAGGAAAGGAACTAGG - Intronic
966948976 3:184798602-184798624 ATGTGTTCAGGGAAAGAAGTTGG - Intergenic
967293805 3:187946705-187946727 GTGAGTTTAGGGAGGCAGGCAGG + Intergenic
968217314 3:196904404-196904426 ATGAGATCAGGGAAGGAGGCAGG + Intronic
968855870 4:3121532-3121554 ATAAGTTTTGGCAAGGAAGATGG - Intronic
969295273 4:6266491-6266513 ATAGGTGTAGGGAAGGAAGTGGG + Intergenic
970672399 4:18411972-18411994 ATGAGAGGAGGGAAGGAAGGAGG - Intergenic
970970023 4:21971607-21971629 TGGATTTTAGGGAAGGGAGCTGG + Intergenic
972893940 4:43595618-43595640 ATGAGTTTAGTGGAGGAGGTTGG - Intergenic
973213516 4:47642755-47642777 AAGAGTGTAGGGAAGGCAGAGGG + Intronic
973541956 4:51943918-51943940 ATGAGATTAGGTGAAGAAGCTGG + Intergenic
974437345 4:61873344-61873366 ATTAGGTTAGGGAGGGAAGTTGG - Intronic
974514970 4:62897213-62897235 ATGAGTTCAGGGAAGGAGGCTGG + Intergenic
976392765 4:84522986-84523008 ATGACTATAGGGAAAGAAGCAGG + Intergenic
977101858 4:92826156-92826178 ATGAGTTCAGAGAAGGTAGGAGG - Intronic
977787352 4:101052921-101052943 AGGTGTTTAGGGGAGGCAGCAGG - Intronic
978167948 4:105631455-105631477 GTGAGTTTGGGGAAAGAAGACGG - Intronic
979215469 4:118158848-118158870 ATGACTCTATGGAAGGAAGGAGG - Intronic
979238095 4:118424201-118424223 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
981118239 4:141017225-141017247 AGGAGTTTAGGAAAAGCAGCTGG - Intronic
981265367 4:142777029-142777051 ATGAGTGTAAAGAAGGCAGCAGG - Intronic
981438123 4:144750122-144750144 ATGAATTTGGGGAAGGGAGAGGG + Intergenic
981737657 4:147969952-147969974 TTGGGTTTAGGGTTGGAAGCAGG + Intronic
981950445 4:150400131-150400153 ATGAAGTTGGGGAAGTAAGCAGG + Intronic
982485772 4:155964209-155964231 ATGAGGTTGAGGAAGGAAGTGGG + Intergenic
983121911 4:163896864-163896886 ATGAGTTTTAGAGAGGAAGCGGG - Intronic
984518140 4:180767553-180767575 ATTAGTCTGGGGAAGCAAGCAGG - Intergenic
984956969 4:185054417-185054439 ATGTGTTCAGGGAACGATGCAGG + Intergenic
986422580 5:7599474-7599496 ATAATTTTAGGGAAGGAAGATGG + Intronic
986986981 5:13511519-13511541 GTGAATGTAGGGAAGGCAGCAGG + Intergenic
988452008 5:31352675-31352697 AGGAGTAGAGGGAAGGAAGGAGG - Intergenic
988500760 5:31781873-31781895 AGGCATTTAGGGAAGGCAGCTGG + Intronic
988657059 5:33223822-33223844 ATGATTTTAAGGAAGGCAGCAGG - Intergenic
989992752 5:50787299-50787321 ATGAGAGCAGGGAAGGAACCTGG - Intronic
990866823 5:60389180-60389202 GTAAGCTTAGGGAAGGAAGAGGG - Intronic
990946418 5:61254286-61254308 ATGAGCTAAGGGAAGGAATGAGG + Intergenic
991353802 5:65747411-65747433 ATGAGAATAGAGAAGGTAGCTGG + Intronic
991422942 5:66459991-66460013 AGGAGTTGAGGGGAGGAAGAAGG - Intergenic
991609186 5:68433379-68433401 AGGAGTTCAGAGAAGGAAGAAGG + Intergenic
993088018 5:83387979-83388001 ATGAGTTATGGGAAGGAAAAAGG - Intergenic
993279568 5:85908126-85908148 ATGACTTCAGGGAAGCAGGCTGG - Intergenic
993426669 5:87773613-87773635 ATGAGTTGGAGAAAGGAAGCAGG - Intergenic
994548069 5:101194306-101194328 ATTATTTTAGGGAAGGAAAGAGG + Intergenic
994831560 5:104789288-104789310 ATGGGTTTCAGCAAGGAAGCCGG + Intergenic
995616848 5:113974054-113974076 TGGAGTTTAGGGAAGAAATCAGG + Intergenic
996176706 5:120368402-120368424 ATGAGCTCAGGGAGGGAGGCTGG + Intergenic
997353962 5:133250457-133250479 ATGAGCTGAGGGAAGCAGGCTGG + Intronic
997549527 5:134739507-134739529 ATGTGTTTGGGGGAGGAAGGAGG - Intronic
997817404 5:137032655-137032677 AAGAGTTTGCGGAAGGAAGGAGG + Intronic
999335150 5:150709312-150709334 ATGCGTTTATGGCAGGTAGCTGG - Intronic
1000001735 5:157144755-157144777 ATGAATTGAGGAAATGAAGCCGG - Intronic
1000555261 5:162718072-162718094 AAGAGTTTAGGGAGGGAGGCTGG - Intergenic
1000935359 5:167299472-167299494 ATGTGTGTAGGGAAGGGAGGGGG + Intronic
1001464033 5:171946484-171946506 ATGAAATCAGGGAAGGAAGGAGG - Intronic
1002738522 5:181416177-181416199 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1003496095 6:6664491-6664513 ATGACTTCAGGGAAGGAAGAGGG - Intergenic
1004109417 6:12700857-12700879 TTGACTCTAGAGAAGGAAGCCGG + Intergenic
1004179333 6:13367456-13367478 ATGGGGGTCGGGAAGGAAGCAGG - Intronic
1004287332 6:14333813-14333835 ATGAGTTTTGGGAGGGAGGGTGG - Intergenic
1005990389 6:30898554-30898576 ATGAGGTTGGGCGAGGAAGCTGG + Intronic
1006896228 6:37472817-37472839 ATGATCTTAGGCAAGGGAGCTGG + Intronic
1007178694 6:39913280-39913302 ATGGGTTGAGGGAGGGAAGAAGG - Intronic
1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG + Intergenic
1008111879 6:47504223-47504245 ATGAGGCCAGGGAATGAAGCTGG - Intronic
1009297510 6:61971790-61971812 ATGTGTTTAAGGAAGGATGGTGG - Intronic
1010010994 6:71048059-71048081 AGTACTTTGGGGAAGGAAGCAGG + Intergenic
1010174919 6:73017050-73017072 ATGAGTTAAGGGACTGGAGCTGG - Intronic
1010923903 6:81720104-81720126 ATGAGATTAAGGAAGGAAGTAGG + Intronic
1011889317 6:92137385-92137407 AGGAGTTTAGTGAGGGAATCAGG + Intergenic
1012150533 6:95745102-95745124 ATGATTTTAGGGAGAGAAGAAGG - Intergenic
1012271891 6:97223405-97223427 TTGGGTTTAGGTAAGGAAGATGG - Intronic
1014320590 6:119924088-119924110 ATTTGTTGAGGGAAAGAAGCTGG + Intergenic
1014410877 6:121118764-121118786 CTGACTTTGGGAAAGGAAGCAGG - Intronic
1015007663 6:128303071-128303093 GTGAGTTTAGGGAAGGAAGGCGG - Intronic
1015324614 6:131910172-131910194 TTCAGTTTGGGGAAGGAACCAGG + Intergenic
1016290509 6:142523760-142523782 ATGAGTTTGGGGGAAGAAGTGGG - Intergenic
1016297326 6:142587243-142587265 ATGTGTTTTGGGAAGGAACCAGG + Intergenic
1016475939 6:144428025-144428047 ATGAATTCAGGGAGGGAAGTGGG + Intronic
1017297704 6:152817899-152817921 ATGAGTTTAGGGGAGAGGGCAGG - Intergenic
1017540457 6:155397147-155397169 ATTAATTTAGGGGAGGATGCTGG - Intronic
1018798289 6:167203780-167203802 CTGAGTCTGGGGAAGGAATCAGG - Intergenic
1018814423 6:167320396-167320418 CTGAGTCTGGGGAAGGAATCAGG + Intergenic
1019243625 6:170691729-170691751 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1021229505 7:18068849-18068871 ATGAGTTAAGAGAAGTAGGCAGG - Intergenic
1021867684 7:24975025-24975047 ATGAGTCTAGACAGGGAAGCAGG + Intronic
1023002820 7:35829049-35829071 ATGAGGTCAGGGAGGCAAGCAGG - Intronic
1023882652 7:44329292-44329314 GTGTGTTTAGGGAATGAAGACGG + Intronic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1026148059 7:67765208-67765230 ATGACTTTAGAGCAGGACGCTGG - Intergenic
1026423710 7:70268288-70268310 AGGAGTCTAGGGAAGGGAGGAGG + Intronic
1026582725 7:71631666-71631688 AGGAGATAAGGGAAGGAAGGAGG + Intronic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1028163081 7:87507978-87508000 ATTAGTGTAGGGAGGGAAGGGGG + Intronic
1028281640 7:88937064-88937086 ATGTGTTTGGGGCAGAAAGCAGG - Intronic
1028527547 7:91802067-91802089 ATGAGTGGAGGGGAGGAGGCGGG - Intronic
1028977817 7:96933524-96933546 AGGAGGCAAGGGAAGGAAGCTGG + Intergenic
1029323778 7:99788282-99788304 TAGAGTTTAGGGAAGAAAGAAGG - Intergenic
1030274292 7:107702906-107702928 AAGAGGTTAGAGTAGGAAGCAGG + Intronic
1030811612 7:113979299-113979321 AGGAATTAAAGGAAGGAAGCTGG - Intronic
1031620596 7:123929862-123929884 AAGAATTTAAAGAAGGAAGCTGG + Intronic
1032450276 7:132024674-132024696 AAGAGGGTAGTGAAGGAAGCAGG + Intergenic
1033218033 7:139508301-139508323 ATGAATTTGTGGAAGGAAGAAGG + Intergenic
1033467465 7:141608514-141608536 ATGAGGTTAGAGAAGTAAGGAGG + Intronic
1033635290 7:143206360-143206382 ATTGGTTGAGGGAAGGAAGTTGG - Intergenic
1033826704 7:145199871-145199893 CTGAGTTGAGGGGATGAAGCTGG - Intergenic
1034053480 7:148008460-148008482 ATGAGAAGAGGAAAGGAAGCAGG - Intronic
1034669506 7:152847421-152847443 ACGAGTTTATGAAAGGATGCTGG - Intronic
1035504497 8:116431-116453 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1037650834 8:20837016-20837038 GTGACATTAGAGAAGGAAGCAGG - Intergenic
1038663078 8:29513831-29513853 ATGAGGCTCTGGAAGGAAGCAGG - Intergenic
1039210179 8:35204726-35204748 ATGAGCTCAGGGAAGGAGGTGGG - Intergenic
1039320096 8:36420045-36420067 ATGAGTTGAGGGAGAGAAGAAGG + Intergenic
1039740406 8:40377760-40377782 CTGAGTTTAGGGAAGGGAGATGG + Intergenic
1045203763 8:100015127-100015149 TTGAGTTCAGGGAAGAAATCAGG - Intronic
1045538727 8:103060516-103060538 ATGGGTTTAGTAAAGGAAACAGG - Intronic
1045613355 8:103875029-103875051 AGGAGTGTTGGGAAAGAAGCTGG + Intronic
1046057748 8:109098617-109098639 ATGAGTTTGGGAAAGTAAGCAGG - Intronic
1046649772 8:116824970-116824992 CTGAGTTGAGGGGATGAAGCTGG - Intronic
1047420069 8:124700299-124700321 ATCAGTTGGGGGAAGGAATCTGG + Intronic
1047733188 8:127743417-127743439 CTGACTTTCGGGAAGGAAGTTGG - Intergenic
1048817866 8:138350923-138350945 ATGACTTTGGGGAGGTAAGCAGG - Intronic
1049120753 8:140734945-140734967 ATGAGATTAGTGAGGAAAGCCGG + Intronic
1049969839 9:812217-812239 ATCGGTTAAGGGAAGGAATCTGG + Intergenic
1050158396 9:2692388-2692410 ATGAGTTTAGGAAAGGACTGAGG + Intergenic
1051912496 9:22170414-22170436 ATGAGTTTAGGAGAGGCTGCTGG + Intergenic
1052474613 9:28942818-28942840 ATTATTTTAGGGAAGGGAGAGGG - Intergenic
1053887063 9:42651687-42651709 ATGAGATTAGGGAAAGCAGGTGG - Intergenic
1054226083 9:62459137-62459159 ATGAGATTAGGGAAAGCAGGTGG - Intergenic
1055964656 9:81853820-81853842 ATATGTTTAGGGAAACAAGCTGG - Intergenic
1058814851 9:108673707-108673729 ATGAGGCTGGAGAAGGAAGCTGG + Intergenic
1059805812 9:117799081-117799103 ATGAGTCTAGAGAAAGAAGCAGG + Intergenic
1060145413 9:121248483-121248505 ATAAATTTATGGAAGGAAGGAGG - Intronic
1060542557 9:124440725-124440747 ATGTGTTTTAGCAAGGAAGCTGG - Intergenic
1203603814 Un_KI270748v1:40952-40974 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1186132635 X:6484758-6484780 AGGATTTTAGGGAAACAAGCAGG - Intergenic
1186367390 X:8909871-8909893 ATGGGAGGAGGGAAGGAAGCTGG + Intergenic
1187357597 X:18591778-18591800 CTGAGTCTAGGGGAGGAAGGAGG - Intronic
1187952638 X:24485828-24485850 GTCAGGTTTGGGAAGGAAGCAGG - Intronic
1190251530 X:48730592-48730614 AAGACTTTAGGGGAGGATGCAGG - Intergenic
1195066026 X:101239167-101239189 ATGAGTTTGGGGAAGGCAGGAGG - Intronic
1195480129 X:105335272-105335294 ATGTGTTAAGGGAAGGTATCTGG - Intronic
1195645674 X:107228394-107228416 ATGATTTTTGAGAAGGAGGCAGG + Intronic
1195713262 X:107792652-107792674 AGGAGTTTAGGGAATGAACCAGG - Intronic
1196136657 X:112217136-112217158 CTGATTGGAGGGAAGGAAGCTGG + Intergenic
1196666914 X:118326650-118326672 ATGTGTTTGGAGAAGTAAGCAGG - Intergenic
1196704844 X:118708149-118708171 ATGAGATCAGGAAAGGCAGCAGG - Intergenic
1197031634 X:121823629-121823651 ATGATCTTAGGGGAGCAAGCTGG - Intergenic
1197522138 X:127511743-127511765 AAGAGTCAAGGGATGGAAGCGGG + Intergenic
1197586633 X:128355943-128355965 CTGAGTCTAGGGAAGGTAGGAGG - Intergenic
1200228130 X:154430657-154430679 CGGCCTTTAGGGAAGGAAGCAGG + Intronic
1200844358 Y:7816200-7816222 ATGAAATTAGCAAAGGAAGCAGG + Intergenic
1202385875 Y:24325997-24326019 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1202484911 Y:25344131-25344153 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic