ID: 1100185427

View in Genome Browser
Species Human (GRCh38)
Location 12:92133927-92133949
Sequence ACATTTACAGGCTTGTGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100185427 Original CRISPR ACATTTACAGGCTTGTGATG AGG Intronic
900851300 1:5145039-5145061 ACATGTACAGGTTTGTTATGTGG + Intergenic
901959346 1:12812083-12812105 ACATTTTGATGCTTTTGATGTGG + Intergenic
905058938 1:35122645-35122667 ACATGCACAGTTTTGTGATGTGG + Intergenic
906555199 1:46705529-46705551 ACATGCACAGTTTTGTGATGTGG - Intronic
906817107 1:48890364-48890386 ACCTTTGCAGGATTGTGGTGAGG + Intronic
908141532 1:61189924-61189946 ACATTTACAGTCTTAGGATAAGG + Intronic
909707099 1:78598502-78598524 ACATTTACAGAATTTTGAAGGGG + Intergenic
910313285 1:85852999-85853021 ACATGTGCAGGTTTGTTATGTGG + Intronic
911240642 1:95462083-95462105 AGATTTATTGGCTTTTGATGTGG + Intergenic
913557980 1:119988160-119988182 GCATTTACAGCCTTGTGAGTGGG + Intronic
913567417 1:120086612-120086634 ACATTTACAAGTTTGGGATGTGG - Intergenic
913630719 1:120706934-120706956 ACATTTACAAGTTTGGGATGTGG + Intergenic
914288164 1:146247318-146247340 ACATTTACAAGTTTGGGATGTGG - Intergenic
914349535 1:146828296-146828318 ACATTAAGAACCTTGTGATGAGG - Intergenic
914549200 1:148698064-148698086 ACATTTACAAGTTTGGGATGTGG - Intergenic
914617482 1:149373655-149373677 ACATTTACAAGTTTGGGATGTGG + Intergenic
915611041 1:156992980-156993002 TCATTTACACATTTGTGATGGGG - Intronic
917619721 1:176783749-176783771 ACAGTTACAGGGCTGTGAGGTGG + Intronic
918645366 1:186897840-186897862 ACATGTACAGGTTTGTTATATGG + Intronic
918932106 1:190867548-190867570 AGATTTAAAGGCATGGGATGGGG - Intergenic
920945590 1:210525350-210525372 ACATTGACATGACTGTGATGGGG - Intronic
921754992 1:218844899-218844921 ACACACACAGGCTTGTGATTGGG + Intergenic
922394327 1:225180855-225180877 ACATGTACAGGTTTGTGACATGG + Intronic
923080559 1:230649752-230649774 ACATGTACAGGTTTATTATGTGG + Intronic
923168466 1:231390431-231390453 ACATTTACACAGTTGTGGTGAGG - Intronic
923822049 1:237455531-237455553 ACATGTGCAGGTTTGTTATGTGG - Intronic
923929290 1:238675117-238675139 ACATTTAAAGCCTCATGATGAGG - Intergenic
924413760 1:243835440-243835462 ACATGTACAGGTTTGTTATATGG - Intronic
1062891304 10:1062554-1062576 GCTTTCACAGGCTTTTGATGTGG + Intronic
1063616737 10:7606694-7606716 ACATATACAGGTTTGTTATATGG - Intronic
1064437975 10:15327892-15327914 ACATGTACAGGTTTGTGATATGG - Intronic
1065838387 10:29679840-29679862 ACATGTACAGGTTTGTGACATGG - Intronic
1067370048 10:45674152-45674174 AACTTTGCAGGATTGTGATGGGG - Intergenic
1067664618 10:48266329-48266351 ACATGTGCAGGCTTGTTATATGG - Intronic
1069145130 10:64882578-64882600 ACATGTACAGGTTTGTTATAAGG - Intergenic
1069283327 10:66682705-66682727 ACATGTACAGGTTTGTTATATGG + Intronic
1069558644 10:69414230-69414252 ACATTTTCAGGCTGCTGAGGTGG - Intronic
1071534502 10:86416595-86416617 ACATTCAAAGGCTTGTGACTAGG + Intergenic
1071724318 10:88181210-88181232 AAATTTCCTGGCTTATGATGGGG - Intergenic
1073715091 10:106096333-106096355 ATATTTATAAGCTTGTTATGAGG + Intergenic
1074881454 10:117662790-117662812 ATATTTAAAGGCTTGTGACTGGG - Intergenic
1076381254 10:130025900-130025922 ACATTTCCAGGCATGTGGTCAGG + Intergenic
1078386059 11:10893864-10893886 GCATTTACAGCTCTGTGATGAGG + Intergenic
1078603020 11:12749906-12749928 ACATTTTGAGGATTGGGATGGGG + Intronic
1079302701 11:19293169-19293191 ACATGTACAGGTTTGTTATATGG + Intergenic
1079604763 11:22351267-22351289 ACATGTACAGGCTTGTCATGTGG + Intronic
1080244309 11:30162724-30162746 ACATGTACAGGTTTATTATGTGG + Intergenic
1080296687 11:30738082-30738104 TTATTTACAGGGTTGTCATGAGG - Intergenic
1080423280 11:32132335-32132357 ACATGTGCAGGTTTGTTATGTGG - Intergenic
1080667790 11:34350933-34350955 ACATTCACAGGATTCTCATGGGG + Intronic
1081238865 11:40679468-40679490 AAACTTCCAGGCCTGTGATGGGG - Intronic
1081402612 11:42660648-42660670 ACATCTACAGGCTTGTTATATGG - Intergenic
1086213371 11:84348013-84348035 ACATTCACAAGCTTGTTATGAGG + Intronic
1086661093 11:89418462-89418484 AAATTTACAGGGTTGTTAGGAGG + Intronic
1093372606 12:18382823-18382845 AAGTTTCCAGGCTTGTGGTGAGG + Intronic
1093739161 12:22661525-22661547 ACATGTACCTGCTTGTAATGGGG + Intronic
1094578480 12:31710584-31710606 ACATTTAAAGGCTTGTGTGGGGG + Intronic
1096614741 12:52825492-52825514 TCACTTACTGGCTTGTGATCTGG - Intronic
1097771460 12:63591426-63591448 ACATGTACAGTCTTGTTATATGG - Intronic
1098064163 12:66594422-66594444 ACATTTACAAATTTGTGTTGGGG - Intronic
1098180038 12:67836974-67836996 ACATTTATTGATTTGTGATGTGG + Intergenic
1098311480 12:69153387-69153409 ACTTTTCCAGGCATGTGGTGGGG - Intergenic
1099787806 12:87288527-87288549 ACATATGCAGGTTTGTTATGTGG + Intergenic
1099830873 12:87840931-87840953 GCATTTAAAGGCTTCTGATAGGG - Intergenic
1100114731 12:91290756-91290778 ACATGTACAGGTTTGTTAGGTGG + Intergenic
1100185427 12:92133927-92133949 ACATTTACAGGCTTGTGATGAGG + Intronic
1100578141 12:95912328-95912350 ACATGTGCAGGTTTGTTATGAGG - Intronic
1100595795 12:96070943-96070965 ATACTAACAGGTTTGTGATGTGG + Intergenic
1100715956 12:97305901-97305923 ACAATTACAGACCTGAGATGCGG + Intergenic
1100760832 12:97804959-97804981 TCATTTACAGGGTTGTTGTGAGG + Intergenic
1102104171 12:110306380-110306402 ACATGTGCAGGTTTGTTATGTGG + Intronic
1104346262 12:128001985-128002007 ACATGTGCAGGCTTGTTATTAGG - Intergenic
1105486847 13:20841717-20841739 ACATTTAAAGGAGTGTGGTGGGG - Intronic
1106009823 13:25809294-25809316 ACATGTACAGGTTTGTTACGTGG - Intronic
1107232572 13:38128157-38128179 ACATGTGCAGGCTTGTTATATGG + Intergenic
1108117726 13:47147899-47147921 ACATTTACAGCCTTTCCATGAGG + Intergenic
1109570880 13:64187970-64187992 ACATTTAAAGCCATGTGACGAGG - Intergenic
1110044693 13:70813323-70813345 AAATTTACAGCCTGGTCATGTGG + Intergenic
1110501294 13:76231380-76231402 ACATTTACTGGCTTCAGAGGAGG + Intergenic
1111230051 13:85333656-85333678 TTATTTACATGCTTGAGATGAGG - Intergenic
1111624978 13:90773418-90773440 AAATGTACCGGCTTGAGATGGGG - Intergenic
1112254347 13:97815761-97815783 ACATGTGCAGGTTTGTCATGTGG - Intergenic
1113320713 13:109229390-109229412 AAATTTGCAGCCTAGTGATGTGG - Intergenic
1114962678 14:27913665-27913687 ACACATACAGGCTTGTTACGTGG - Intergenic
1115121323 14:29941430-29941452 AAATTTGCAGCCTGGTGATGTGG + Intronic
1116347202 14:43809305-43809327 ACATTTATATGCTGTTGATGGGG + Intergenic
1116426826 14:44800554-44800576 ACATTTTCAGGCTTGTTATATGG - Intergenic
1118651765 14:67903782-67903804 ACATGTGCAGGTTTGTTATGTGG + Intronic
1118825373 14:69375499-69375521 TCATCTACAGGCTTTTGTTGTGG - Intergenic
1120244097 14:81985533-81985555 ACATATACAAGCTTGAGATGAGG + Intergenic
1120686087 14:87539517-87539539 ACATTTACAAACTGGTGTTGGGG - Intergenic
1121725415 14:96144757-96144779 ACATGTACAGGTTTGTTATATGG - Intergenic
1121927390 14:97940776-97940798 ACATTTTCAGGCTTATGACATGG + Intronic
1122407928 14:101511405-101511427 ACATTTACAGTCTTGTGATGGGG + Intergenic
1124191223 15:27578880-27578902 AGATTTCCAGACATGTGATGAGG + Intergenic
1126522184 15:49607289-49607311 ACATTTACAGGATTTGGAAGAGG - Intronic
1127043063 15:54998371-54998393 ACATTTTCAGGTTTGTGCTCTGG - Intergenic
1131886039 15:96914168-96914190 ACATTTAAAAGCTTCTTATGAGG + Intergenic
1131898804 15:97065180-97065202 TCATTTAGAGACTTGTTATGTGG - Intergenic
1132182189 15:99764887-99764909 ACATATACAGGTTTGTTACGTGG - Intergenic
1137518699 16:49173235-49173257 ACATTCCCAGCCTTGTGGTGAGG - Intergenic
1139450581 16:67025629-67025651 AAACTTACAGGGTTGTGGTGAGG + Intergenic
1141598388 16:85111140-85111162 ACAGTTACACGCTGGGGATGAGG - Intronic
1142302417 16:89266432-89266454 TCATTTACGGGCTTGGGGTGGGG - Intergenic
1143094439 17:4470043-4470065 ACATTCACAGGCTTATGGTTAGG + Intronic
1143261177 17:5599478-5599500 ACCATTACAGGCTTGCTATGAGG - Intronic
1144679613 17:17184272-17184294 ACACTCACAGGCCTCTGATGAGG + Intronic
1145077983 17:19870838-19870860 ACACCCACAGGCTTGTGTTGGGG - Intergenic
1146509500 17:33433836-33433858 ACATGTGCAGGTTTGTTATGTGG - Intronic
1149413696 17:56435895-56435917 AAATTTCAAGGCTTATGATGTGG - Intronic
1149455051 17:56780994-56781016 GTACTTACAGGGTTGTGATGAGG - Intergenic
1149797836 17:59537485-59537507 ACATTTACAGCTTTGTGCAGTGG - Intergenic
1149882262 17:60304859-60304881 ATATTTAAATGCTTGTTATGTGG + Intronic
1149903858 17:60507090-60507112 ACATTTGCAGGCTTGTTACACGG + Intronic
1150074744 17:62182929-62182951 ACATTTACAGTCTTGCCCTGGGG - Intergenic
1152026770 17:77814984-77815006 ACATGTGCAGGTTTGTTATGTGG + Intergenic
1153326499 18:3826235-3826257 ACATGTGCAGGCTTGTTACGTGG - Intronic
1153531373 18:6049829-6049851 ACATGTACAGGTTTGTTATACGG - Intronic
1154094270 18:11396195-11396217 ACATATACAGGCTTATTATCGGG - Intergenic
1155913361 18:31531205-31531227 AAATTTTCAAGCTTTTGATGAGG + Exonic
1156470077 18:37371869-37371891 GCATTCCCAGGCTTGTCATGTGG - Intronic
1157975842 18:52325741-52325763 ACATGTGCAGGTTTGTTATGTGG - Intergenic
1158168277 18:54566824-54566846 ACATTTACACACTTTTGGTGAGG + Intergenic
1159380208 18:67646601-67646623 ACATTTATAGATTTGTTATGTGG - Intergenic
1159522260 18:69541294-69541316 ATATGTACTTGCTTGTGATGGGG + Intronic
1160478826 18:79219419-79219441 ACATTAATAGGTTTGTGATATGG - Intronic
1160605116 18:80044428-80044450 ACATTCACAGGCCTGTGCTGTGG + Intronic
1161536100 19:4819482-4819504 ACACTTACAGACTTGTTTTGGGG + Intronic
1162461620 19:10817197-10817219 ACATTTACAGCCATGGGGTGGGG + Intronic
1163204514 19:15792838-15792860 AAATTGACAGGGTTGTTATGAGG - Intergenic
1164957491 19:32399415-32399437 ACATTTACAATCTTGAGATGGGG + Intergenic
1165683587 19:37798616-37798638 ACATGTGCAGGCTTGTTATATGG - Intronic
925480817 2:4272250-4272272 ACATGTACAGGTTTGTTATTTGG + Intergenic
926566087 2:14475733-14475755 ACATGTGCAGGTTTGTTATGTGG - Intergenic
927604360 2:24472848-24472870 ACATGTACAGGTTTGTTACGTGG - Intergenic
929189062 2:39122856-39122878 ATATTTAAAGGGTTGTGATATGG + Intronic
929247727 2:39720803-39720825 AAATGTACAGTCGTGTGATGAGG + Intergenic
929255301 2:39804416-39804438 ACATATACAGGTTTGTTATACGG + Intergenic
929400495 2:41574950-41574972 ACATGTAAACTCTTGTGATGTGG + Intergenic
930312956 2:49764768-49764790 ACATTTACAGTATTGTCATGTGG + Intergenic
932497165 2:72151530-72151552 CCATGGACAGGCTTGTGAAGAGG + Intergenic
933190378 2:79327719-79327741 CCATTTACAGACTAGTGAGGAGG - Intronic
934316839 2:91929503-91929525 ACATTAGCAGGCTTGTTATATGG - Intergenic
934732037 2:96665492-96665514 ACCTTTTCCGGCCTGTGATGAGG + Intergenic
935817876 2:106864169-106864191 AGAATTACAGGATTGTGATCAGG - Intronic
936979823 2:118254214-118254236 ACATTCACAGGGTTGTTAAGAGG - Intergenic
938569482 2:132549285-132549307 CCATGTACAGGCTTGGGGTGTGG - Intronic
939364856 2:141218736-141218758 ACATGTACAGGTTTATTATGTGG - Intronic
939390575 2:141563977-141563999 ACATTTTCAGGTTTGTTACGTGG - Intronic
939481961 2:142760339-142760361 ACATGTGCAGGTTTGTTATGAGG - Intergenic
939882293 2:147644036-147644058 TCATTTATAGTCTTGTGTTGAGG - Intergenic
941143510 2:161814883-161814905 ACATGTGCAGGCTTGTTATATGG - Intronic
941514468 2:166455656-166455678 ACATGTGCAGGTTTGTTATGTGG - Intronic
942886448 2:180930699-180930721 ACATGTACAGGTTTGTTATATGG + Intergenic
944081384 2:195792323-195792345 ACATTTACAGGTTTGTTAAATGG - Intronic
944290620 2:198000317-198000339 ACATGTACAGGTTTGTTATCTGG + Intronic
945104261 2:206294521-206294543 ACATGTCCAGGCTTGTTACGTGG + Intronic
946518877 2:220444472-220444494 ATATTTTCAGGCTTGTGACATGG + Intergenic
948113542 2:235476607-235476629 ACATGTGCAGGCTTGTTACGTGG - Intergenic
948503495 2:238411570-238411592 ACATTTAGGGGCTTTGGATGTGG + Intergenic
1169592774 20:7163714-7163736 AAGTTTACAGCCTGGTGATGGGG + Intergenic
1169608699 20:7353759-7353781 AACTTTACAGGCTTGTTATGAGG - Intergenic
1169621305 20:7509404-7509426 ACATGTACAGGTTTGTTATAAGG - Intergenic
1169984426 20:11427225-11427247 ACATCTAGAGGTTAGTGATGAGG - Intergenic
1170755159 20:19196913-19196935 ACATGTACAGGTTTATTATGTGG + Intergenic
1173744278 20:45424565-45424587 ACACTTACAGGCTGTTGAAGAGG - Exonic
1174574802 20:51529371-51529393 ACATTTAAAGTCTTGTCAAGAGG - Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1179378685 21:40878472-40878494 ACATTTAAACGCTTGCGATGAGG - Intergenic
1180116538 21:45709611-45709633 AGATTTACAGAATTATGATGAGG + Intronic
1181557440 22:23679381-23679403 ACATGTGCAGGTTTGTTATGTGG - Intergenic
1181794570 22:25296169-25296191 ACATGTGCAGGTTTGTTATGTGG + Intergenic
1181834551 22:25592683-25592705 ACATGTGCAGGTTTGTTATGTGG + Intronic
1181927118 22:26368914-26368936 AAATTTACAGTCATGAGATGCGG - Intronic
1183563821 22:38598280-38598302 AAACTTACAGTGTTGTGATGAGG - Intronic
1184159864 22:42691829-42691851 ACAGATTCAGGCTTGTCATGGGG + Intergenic
950336927 3:12202310-12202332 ACATGTCCAGGTTTGTTATGTGG - Intergenic
952607697 3:35170062-35170084 ATATTTCCAGCTTTGTGATGTGG + Intergenic
954960286 3:54558453-54558475 ACATGTGCAGGTTTGTTATGTGG + Intronic
955471609 3:59292346-59292368 ACATGTGCAGGTTTGTTATGTGG + Intergenic
956238941 3:67107379-67107401 ACATGCACAGCCTTGGGATGTGG - Intergenic
956277538 3:67519164-67519186 ACATGTACAGATTTGGGATGTGG - Intronic
956963039 3:74425111-74425133 ACACGTACAGGTTTGTTATGTGG + Intronic
957737391 3:84219774-84219796 ACATGTACAGGCTTGTTACATGG - Intergenic
957982218 3:87525186-87525208 AAATTTGCAGCCTGGTGATGCGG + Intergenic
958073832 3:88650684-88650706 ACATGTTCAGGTTTGTTATGTGG - Intergenic
959130147 3:102344871-102344893 CCATTTTCAGTCTAGTGATGAGG + Intronic
960532126 3:118776911-118776933 ACATGTACAGGTTTGTTATCTGG - Intergenic
962116033 3:132508719-132508741 ACATGTACAGGCTTGTTACCTGG - Intronic
962365959 3:134781604-134781626 ACATGTACAGGTTTGTTACGTGG - Intronic
963673799 3:148283450-148283472 ACATGTGCAGGTTTGTTATGTGG + Intergenic
964280727 3:155061545-155061567 ACAAATACAGGTTTGTAATGTGG - Intronic
964458677 3:156897160-156897182 ACATATACAGGTTTGTTATATGG - Intronic
964675696 3:159277632-159277654 ATATTTACAGGCTGGTGCAGTGG + Intronic
964862277 3:161216095-161216117 ACTTTTACATGTTAGTGATGGGG - Intronic
965280734 3:166748740-166748762 ACATGTGCAGGTTTGTTATGAGG + Intergenic
966442700 3:179963987-179964009 ACATGTACAGGTTTGTTATATGG + Intronic
966946196 3:184778741-184778763 CCATTTTCAGGTCTGTGATGAGG - Intergenic
967885371 3:194330025-194330047 AGGTTTACAGGCCTATGATGGGG + Intergenic
968607717 4:1543343-1543365 ACTTCTTCATGCTTGTGATGAGG - Intergenic
968967818 4:3778178-3778200 ACCTGTGCAGTCTTGTGATGGGG + Intergenic
971035330 4:22686742-22686764 TCATTTCCAGGCTGGTGATATGG + Intergenic
972197928 4:36676436-36676458 ACAGTAAAAGGCTTGTGATTTGG - Intergenic
972291918 4:37697518-37697540 ACCTTCACAGGCTTGGGTTGTGG + Intergenic
972952488 4:44344675-44344697 ACAAATACAGGCATGAGATGTGG + Intronic
973620986 4:52725521-52725543 ACATGTACAGGCTTGTTACCTGG - Intronic
974710446 4:65587261-65587283 ACATTGTCAGGATTCTGATGTGG - Intronic
975226464 4:71877921-71877943 TCATTTACAGGCAAGGGATGGGG + Intergenic
976817278 4:89163715-89163737 ATATTCACAGGCTTAGGATGTGG + Intergenic
977583680 4:98751238-98751260 ACATGTGCAGGTTTGTTATGTGG - Intergenic
978633901 4:110780755-110780777 ACATCTACTGGCTGTTGATGTGG + Intergenic
979288856 4:118957760-118957782 TCATTTACAGGTTTGTTGTGAGG - Intronic
980296796 4:130929641-130929663 ACATTTAAAGTTTTGTTATGAGG - Intergenic
980613900 4:135194078-135194100 AAATTTTCAGGCTTGCCATGTGG + Intergenic
981147449 4:141341710-141341732 ACATTTACAAAGTTGTGCTGGGG + Intergenic
981711543 4:147713641-147713663 ACATGTGCAGGTTTGTTATGTGG - Intergenic
982039627 4:151383557-151383579 ACATGTACAGGTTTGTTACGTGG + Intergenic
982607859 4:157537388-157537410 ACATTTTCAGGCTGGCCATGTGG + Intergenic
983293142 4:165831875-165831897 ACATGAACAGGTTTGTCATGTGG + Intergenic
986381039 5:7185952-7185974 ACATGTGCAGGCTTGTTATATGG - Intergenic
986924452 5:12730139-12730161 ACATGTGCAGGTTTGTTATGTGG - Intergenic
988113749 5:26855969-26855991 AAATTTACAGGCTGGCCATGTGG - Intergenic
989078215 5:37587450-37587472 AAATTTACAGACTAGAGATGGGG - Intronic
989268161 5:39501607-39501629 ACATTTACTGGAATGGGATGCGG + Intergenic
989299256 5:39869584-39869606 ACATGTACAGGCTTGTTACCTGG + Intergenic
989439914 5:41458125-41458147 ACATTAGCAGGCGTGGGATGAGG - Intronic
989499812 5:42152312-42152334 ACAATTAGAGGCTGGTGAGGAGG - Intergenic
990615803 5:57507159-57507181 GCATTTACATGCTTGTGAGAAGG + Intergenic
993707423 5:91186886-91186908 CCATATACAAGGTTGTGATGGGG + Intergenic
993863307 5:93162177-93162199 TCATTTACAGCATTTTGATGTGG + Intergenic
994336993 5:98578678-98578700 ACATTTACAGGTTTGTTACATGG + Intergenic
994610602 5:102033447-102033469 ATATTTAAAGACTTCTGATGAGG - Intergenic
994660721 5:102650865-102650887 ACATTTCCAGGCCTGGCATGGGG + Intergenic
995681784 5:114728591-114728613 TCATTAACTGACTTGTGATGGGG - Intergenic
997091404 5:130863459-130863481 ACATCTACAAGATTGTGAGGGGG - Intergenic
997388220 5:133491066-133491088 ACATGTGCAGGTTTGTTATGTGG - Intronic
998962453 5:147503026-147503048 ACTGTTGAAGGCTTGTGATGAGG - Intronic
999746646 5:154597431-154597453 CCACTTACTAGCTTGTGATGTGG + Intergenic
1000989840 5:167900423-167900445 ACTTTTCCAGGCTTGGCATGAGG + Intronic
1000991456 5:167916026-167916048 TAATTTATAGGTTTGTGATGAGG + Intronic
1003711875 6:8602109-8602131 ACATTTCCAGGCTGGTACTGGGG - Intergenic
1004649521 6:17595434-17595456 ACATGGACAGGCTTCTGGTGTGG - Intergenic
1006964557 6:37969208-37969230 TCATTTACAGGAATGTTATGTGG + Intronic
1008202489 6:48608358-48608380 ACATTTAAAGTCTTGCCATGTGG + Intergenic
1008612811 6:53199910-53199932 ACATGTGCAGGTTTGTTATGTGG + Intergenic
1008852155 6:56035227-56035249 ACATATGCAGGTTTGTTATGTGG - Intergenic
1009682201 6:66910329-66910351 ACATGTACAGGTTTGTTATATGG + Intergenic
1010318654 6:74480571-74480593 ACATTCACAGTCTTGTGCTTGGG + Intergenic
1010630551 6:78192374-78192396 AAATTTGCAGGCTGGTCATGTGG - Intergenic
1011170789 6:84502436-84502458 ACATATACAGGACTGTTATGTGG - Intergenic
1011356203 6:86475412-86475434 ACATTTACAAGGCTGGGATGAGG - Intergenic
1011645010 6:89449201-89449223 ACATTAACAGGGTTCTGAAGAGG + Intronic
1011848622 6:91598501-91598523 ACATTTTCATGTTTGAGATGAGG + Intergenic
1011981754 6:93387117-93387139 AAATTTGCAGCCTAGTGATGTGG - Intronic
1012008306 6:93745081-93745103 ACATGTACAGGCTTGTTACATGG - Intergenic
1012639935 6:101597335-101597357 ACATTTGCAGGCTTGTTACAAGG - Intronic
1013795513 6:113883858-113883880 ACATGTACAGCATTATGATGGGG + Intergenic
1014529802 6:122545470-122545492 ACATGTATAGGTTTGTTATGTGG + Intronic
1015193031 6:130492830-130492852 ACATGTCCAGGTTTGTTATGTGG + Intergenic
1017547078 6:155464081-155464103 ACATGTGCAGGTTTGTTATGTGG + Intergenic
1018078507 6:160238216-160238238 ACAGAGACAGGCTTGTTATGAGG + Intronic
1019192498 6:170261071-170261093 AAATTTAAAGGTTTGTAATGTGG + Intergenic
1020109734 7:5441423-5441445 AAATTCACAGGCTGGTGAGGTGG - Intronic
1020907629 7:14084033-14084055 ATATTTGCAGGCTTGTGGAGTGG + Intergenic
1021380003 7:19955329-19955351 AAATTTACAGCCTGGTCATGTGG + Intergenic
1024841146 7:53588914-53588936 GCATGTGCAGGCTTGTTATGTGG - Intergenic
1025065924 7:55856031-55856053 ACATTTGCAGGTTTGTTATGAGG + Intronic
1025702948 7:63836624-63836646 ACATATGCAGGTTTGTTATGTGG + Intergenic
1030675488 7:112381215-112381237 GCATGTACAGGTTTGTTATGTGG + Intergenic
1031467564 7:122132157-122132179 GCATTTAAAGCCTTGTTATGAGG - Intronic
1034409551 7:150932818-150932840 ACATGTGCAGGTTTGTTATGTGG - Intergenic
1035302006 7:157903431-157903453 ACATGTGCAGGCTTGTGACCTGG - Intronic
1036405588 8:8452104-8452126 ACATGTGCAGGTTTGTTATGTGG - Intergenic
1038519750 8:28220630-28220652 ACATGTGCAGGCTTGTTATATGG + Intergenic
1039085951 8:33779985-33780007 ACATTTGCAGGTTTGTTATGTGG + Intergenic
1040973294 8:53161454-53161476 ACATGTACAGGTTTGTTATATGG + Intergenic
1041715720 8:60930259-60930281 ACATGTGCAGGTTTGTTATGTGG + Intergenic
1041791886 8:61705359-61705381 ACATATACAGGTTTGTTATATGG - Intronic
1042198298 8:66253430-66253452 ACTTTTACACTCTTGTGATGGGG + Intergenic
1042693384 8:71528602-71528624 ACATTCACAGGGTTAAGATGAGG - Intronic
1043153426 8:76747303-76747325 ACATGTACAGGTTTGTTATGTGG + Intronic
1045612395 8:103861012-103861034 ACATATACAGGTTTGTTATATGG + Intronic
1047717828 8:127611963-127611985 ACATCTACATGCTTCTGATGGGG + Intergenic
1050753473 9:8969254-8969276 ACATCTACAGGAATTTGATGAGG - Intronic
1051442725 9:17103295-17103317 ACATGTGCAGGTTTGTTATGTGG + Intergenic
1052105489 9:24509928-24509950 AAATTTGCAGCCTTATGATGCGG + Intergenic
1052664610 9:31478515-31478537 ACATGTGCAGGCTTGTGACACGG - Intergenic
1052984373 9:34475626-34475648 ACAATCAGAGGCTTGTTATGAGG - Intronic
1053116462 9:35508362-35508384 ACATTCACAGGCATGTGTGGAGG - Intronic
1053305498 9:36981657-36981679 CCATTTACTGGCTCCTGATGTGG - Intronic
1054902996 9:70389178-70389200 ATATTTAAAGGATTATGATGTGG - Intronic
1055241016 9:74186346-74186368 ATATTTATAGACTTTTGATGAGG - Intergenic
1055646504 9:78366599-78366621 ACATGTGCAGGTTTGTTATGTGG - Intergenic
1055648520 9:78384017-78384039 GCACTTACAGTGTTGTGATGAGG - Intergenic
1056013814 9:82360806-82360828 ACATCTACAGCCTTGGGATATGG - Intergenic
1056298921 9:85221812-85221834 ACATGTGCAGGTTTGTGATGTGG - Intergenic
1057029455 9:91763286-91763308 ACATGTACAGGTTTGTGACATGG - Intronic
1059077360 9:111208076-111208098 ACATGTGCAGGTTTGTTATGTGG + Intergenic
1059115119 9:111594455-111594477 ACATATGCAGGCTTGTTATATGG - Intronic
1060306252 9:122414980-122415002 ACATGTGCAGGTTTGTTATGTGG + Intergenic
1060430380 9:123546174-123546196 ACATTTACACATTCGTGATGTGG + Intronic
1062325305 9:136009930-136009952 ACATTTCAAGTCTTGGGATGGGG + Exonic
1062537242 9:137026458-137026480 TCCTTGCCAGGCTTGTGATGTGG - Intronic
1186166663 X:6833714-6833736 ACATTTACAGCTCTGTGATCTGG + Intergenic
1188287658 X:28347789-28347811 ACATGTGCAGGTTTGTTATGTGG + Intergenic
1188601712 X:31974378-31974400 ACATGTACAGGCTTGTCACAGGG - Intronic
1188727157 X:33599929-33599951 ACATTCACATCATTGTGATGTGG + Intergenic
1188840617 X:35012486-35012508 ACATGTGCAGGTTTGTTATGTGG - Intergenic
1189089752 X:38068876-38068898 ACATGTACAGGTTTGTTACGTGG - Intronic
1189361197 X:40353558-40353580 ACATGTGCAGGTTTGTTATGCGG + Intergenic
1189720370 X:43909855-43909877 ACATGTGCAGGTTTGTTATGTGG + Intergenic
1190836041 X:54101507-54101529 AAATTCACAGCCTTGTCATGTGG - Intronic
1191586684 X:62834436-62834458 AAATTTGCAGCCTGGTGATGTGG - Intergenic
1192008585 X:67242977-67242999 GCTTTCACAGGCTTGTGTTGAGG - Intergenic
1193170693 X:78332348-78332370 ACATGTACAGGTTTGTTACGTGG - Intergenic
1193183722 X:78487686-78487708 ACATGTGCACGCTTGTCATGAGG - Intergenic
1195434828 X:104830102-104830124 ACATTTACAGGCTGTTAAAGTGG + Intronic
1195506404 X:105662706-105662728 AAATTTACAGCCATGTCATGAGG + Intronic
1198019074 X:132640913-132640935 ACATGTGCAGGCTTGTTATATGG + Intronic
1199127614 X:144141509-144141531 ACTTTAACTGGCTTGTCATGCGG + Intergenic
1199910478 X:152281469-152281491 AGTTTCACAGGCTTGTGGTGAGG - Intronic
1200300536 X:154970218-154970240 ACATTCATAGGGTTGTTATGAGG - Intronic