ID: 1100188998

View in Genome Browser
Species Human (GRCh38)
Location 12:92170625-92170647
Sequence CTGTAGCCATGGATGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100188998_1100189008 28 Left 1100188998 12:92170625-92170647 CCCACTTCCATCCATGGCTACAG No data
Right 1100189008 12:92170676-92170698 GCCAGTGAATTTATTCACTGGGG No data
1100188998_1100189006 26 Left 1100188998 12:92170625-92170647 CCCACTTCCATCCATGGCTACAG No data
Right 1100189006 12:92170674-92170696 TAGCCAGTGAATTTATTCACTGG No data
1100188998_1100189010 29 Left 1100188998 12:92170625-92170647 CCCACTTCCATCCATGGCTACAG No data
Right 1100189010 12:92170677-92170699 CCAGTGAATTTATTCACTGGGGG No data
1100188998_1100189007 27 Left 1100188998 12:92170625-92170647 CCCACTTCCATCCATGGCTACAG No data
Right 1100189007 12:92170675-92170697 AGCCAGTGAATTTATTCACTGGG No data
1100188998_1100189003 -8 Left 1100188998 12:92170625-92170647 CCCACTTCCATCCATGGCTACAG No data
Right 1100189003 12:92170640-92170662 GGCTACAGGAGTAGTCATGATGG No data
1100188998_1100189004 -7 Left 1100188998 12:92170625-92170647 CCCACTTCCATCCATGGCTACAG No data
Right 1100189004 12:92170641-92170663 GCTACAGGAGTAGTCATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100188998 Original CRISPR CTGTAGCCATGGATGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr