ID: 1100199194

View in Genome Browser
Species Human (GRCh38)
Location 12:92280287-92280309
Sequence TGATCTACAATCAGACTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100199191_1100199194 8 Left 1100199191 12:92280256-92280278 CCATTGCAGCTCAGGAGACATTA No data
Right 1100199194 12:92280287-92280309 TGATCTACAATCAGACTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100199194 Original CRISPR TGATCTACAATCAGACTCTC TGG Intergenic
No off target data available for this crispr