ID: 1100201062

View in Genome Browser
Species Human (GRCh38)
Location 12:92298293-92298315
Sequence CTGCATTCTCAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100201052_1100201062 20 Left 1100201052 12:92298250-92298272 CCAAATGCCACAGCTTCACTGGA No data
Right 1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG No data
1100201053_1100201062 13 Left 1100201053 12:92298257-92298279 CCACAGCTTCACTGGAGCAGCCC No data
Right 1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG No data
1100201050_1100201062 21 Left 1100201050 12:92298249-92298271 CCCAAATGCCACAGCTTCACTGG No data
Right 1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG No data
1100201054_1100201062 -7 Left 1100201054 12:92298277-92298299 CCCAGATATTTCCCCACTGCATT No data
Right 1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG No data
1100201055_1100201062 -8 Left 1100201055 12:92298278-92298300 CCAGATATTTCCCCACTGCATTC No data
Right 1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100201062 Original CRISPR CTGCATTCTCAGAGGGAAGA GGG Intergenic
No off target data available for this crispr