ID: 1100201454

View in Genome Browser
Species Human (GRCh38)
Location 12:92302819-92302841
Sequence CATCATCTCTAGAAGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100201454_1100201456 9 Left 1100201454 12:92302819-92302841 CCATGCTGCTTCTAGAGATGATG No data
Right 1100201456 12:92302851-92302873 GCCAGTCAACAATTCTCAAGCGG No data
1100201454_1100201458 14 Left 1100201454 12:92302819-92302841 CCATGCTGCTTCTAGAGATGATG No data
Right 1100201458 12:92302856-92302878 TCAACAATTCTCAAGCGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100201454 Original CRISPR CATCATCTCTAGAAGCAGCA TGG (reversed) Intergenic
No off target data available for this crispr