ID: 1100206065

View in Genome Browser
Species Human (GRCh38)
Location 12:92351031-92351053
Sequence ATCTGCTGGTTCCTTGATTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100206062_1100206065 -7 Left 1100206062 12:92351015-92351037 CCTCACCAGACACTGAATCTGCT 0: 174
1: 561
2: 1219
3: 1856
4: 2511
Right 1100206065 12:92351031-92351053 ATCTGCTGGTTCCTTGATTCCGG No data
1100206061_1100206065 6 Left 1100206061 12:92351002-92351024 CCAGAAAGTGGAACCTCACCAGA No data
Right 1100206065 12:92351031-92351053 ATCTGCTGGTTCCTTGATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100206065 Original CRISPR ATCTGCTGGTTCCTTGATTC CGG Intergenic
No off target data available for this crispr