ID: 1100207186

View in Genome Browser
Species Human (GRCh38)
Location 12:92363590-92363612
Sequence GAGAAGAATGAGGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2731
Summary {0: 1, 1: 0, 2: 33, 3: 339, 4: 2358}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100207186_1100207190 -7 Left 1100207186 12:92363590-92363612 CCTGCCTCCTCCTCATTCTTCTC 0: 1
1: 0
2: 33
3: 339
4: 2358
Right 1100207190 12:92363606-92363628 TCTTCTCCCCTCCCCGACACTGG 0: 1
1: 0
2: 3
3: 22
4: 278
1100207186_1100207197 18 Left 1100207186 12:92363590-92363612 CCTGCCTCCTCCTCATTCTTCTC 0: 1
1: 0
2: 33
3: 339
4: 2358
Right 1100207197 12:92363631-92363653 TGAATGCATACTCTTCACACAGG 0: 1
1: 0
2: 1
3: 9
4: 136
1100207186_1100207198 27 Left 1100207186 12:92363590-92363612 CCTGCCTCCTCCTCATTCTTCTC 0: 1
1: 0
2: 33
3: 339
4: 2358
Right 1100207198 12:92363640-92363662 ACTCTTCACACAGGACCCACAGG 0: 1
1: 0
2: 0
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100207186 Original CRISPR GAGAAGAATGAGGAGGAGGC AGG (reversed) Intergenic
Too many off-targets to display for this crispr