ID: 1100210749

View in Genome Browser
Species Human (GRCh38)
Location 12:92396206-92396228
Sequence ACTCAAGGTGCAGCCAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100210746_1100210749 -2 Left 1100210746 12:92396185-92396207 CCAGTTACTTGGTGCCTTGCTAC No data
Right 1100210749 12:92396206-92396228 ACTCAAGGTGCAGCCAGCCCAGG 0: 1
1: 0
2: 3
3: 20
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100210749 Original CRISPR ACTCAAGGTGCAGCCAGCCC AGG Intergenic