ID: 1100210751

View in Genome Browser
Species Human (GRCh38)
Location 12:92396208-92396230
Sequence TCAAGGTGCAGCCAGCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100210746_1100210751 0 Left 1100210746 12:92396185-92396207 CCAGTTACTTGGTGCCTTGCTAC No data
Right 1100210751 12:92396208-92396230 TCAAGGTGCAGCCAGCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100210751 Original CRISPR TCAAGGTGCAGCCAGCCCAG GGG Intergenic