ID: 1100213381

View in Genome Browser
Species Human (GRCh38)
Location 12:92421694-92421716
Sequence AACTCCTGGTTTAAGTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 1, 2: 4, 3: 22, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100213381_1100213384 -4 Left 1100213381 12:92421694-92421716 CCTTCAGACTTAAACCAGGAGTT 0: 1
1: 1
2: 4
3: 22
4: 161
Right 1100213384 12:92421713-92421735 AGTTACACCTTTGGCTTCCCTGG 0: 1
1: 11
2: 45
3: 173
4: 579
1100213381_1100213389 17 Left 1100213381 12:92421694-92421716 CCTTCAGACTTAAACCAGGAGTT 0: 1
1: 1
2: 4
3: 22
4: 161
Right 1100213389 12:92421734-92421756 GGTTCTCAGTTCTTTGGACTTGG 0: 1
1: 4
2: 77
3: 240
4: 592
1100213381_1100213386 11 Left 1100213381 12:92421694-92421716 CCTTCAGACTTAAACCAGGAGTT 0: 1
1: 1
2: 4
3: 22
4: 161
Right 1100213386 12:92421728-92421750 TTCCCTGGTTCTCAGTTCTTTGG 0: 1
1: 1
2: 38
3: 180
4: 677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100213381 Original CRISPR AACTCCTGGTTTAAGTCTGA AGG (reversed) Intronic
901747750 1:11385738-11385760 AAGTCCTGGTCTGAGTCTGAAGG + Intergenic
901912551 1:12472252-12472274 AGCTCTTGGTTTGAGGCTGAGGG + Intronic
904494103 1:30877150-30877172 GACTCCTGCTCGAAGTCTGAGGG + Exonic
907116501 1:51973053-51973075 AATTCCTGGCTTCAGTTTGAAGG - Intronic
907882226 1:58561268-58561290 AAATCCTAGTCCAAGTCTGAAGG - Intergenic
908734205 1:67258755-67258777 AACTGGTGGTTTAAGTGTTAAGG - Exonic
909759927 1:79273541-79273563 AACCACTGGTTTAAGTCCAAGGG + Intergenic
910431694 1:87165984-87166006 AAGTCCTGGTTCAAGTCTGAAGG + Intronic
911727385 1:101256571-101256593 AACTCCTGGCTCAATACTGATGG - Intergenic
912172820 1:107121410-107121432 AACACCTCGTTTAATTCTCATGG - Intergenic
913560678 1:120015740-120015762 ACCTCCTGGCTGAGGTCTGATGG + Intronic
913637448 1:120777858-120777880 ACCTCCTGGCTGAGGTCTGATGG - Intergenic
914281261 1:146175155-146175177 ACCTCCTGGCTGAGGTCTGATGG + Intronic
914542306 1:148626090-148626112 ACCTCCTGGCTGAGGTCTGATGG + Intronic
914624328 1:149445152-149445174 ACCTCCTGGCTGAGGTCTGATGG - Intergenic
916254687 1:162774793-162774815 AACCCCTGGTTTGAGACGGAAGG + Intronic
917680489 1:177361205-177361227 AACTCGTTGTATAACTCTGATGG + Intergenic
918622139 1:186618013-186618035 AACACTTTGTTTTAGTCTGAGGG - Intergenic
919963280 1:202494000-202494022 AACTCCTGGTTTACCTAAGATGG + Intronic
923495329 1:234519649-234519671 CACTCCTGGTGTATGTCTGTGGG - Intergenic
924492269 1:244550040-244550062 GAGTCCTGGTCCAAGTCTGAAGG - Intronic
1064909297 10:20383048-20383070 AACTCCTAGTCCAAGGCTGAAGG - Intergenic
1066368777 10:34801594-34801616 AACTCCTGGGTGAAGTCTTCAGG + Intronic
1068812175 10:61268525-61268547 AAGTCCTGCTCTGAGTCTGAAGG - Intergenic
1068824761 10:61423514-61423536 AACTCCTGGTTTCAGTCCCCCGG - Intronic
1070444266 10:76479620-76479642 AAGTCATGGTTGAACTCTGAAGG + Intronic
1072260323 10:93664043-93664065 AACTCCTGCTTTTATTCTGAAGG - Intronic
1075337636 10:121619861-121619883 AACTCCTGCTTCAAGTCTCCTGG + Intergenic
1081969950 11:47191213-47191235 AACTCCTGGCTCAATACTGATGG + Intergenic
1087113438 11:94496334-94496356 ATCTACTGGTTTAGGTATGATGG - Intronic
1087238473 11:95748548-95748570 AACTGCTGATTTAAGGCTAAGGG + Intergenic
1087634740 11:100689292-100689314 AAATCCTGGTTAAAGTCTCGCGG + Intronic
1087892190 11:103547970-103547992 ACATCCTGTTTTAAGTCAGATGG + Intergenic
1091196605 11:133736774-133736796 CAGTCCATGTTTAAGTCTGAAGG - Intergenic
1092742330 12:11641817-11641839 AACTCCCAGTTCAAGGCTGAAGG - Intergenic
1094285749 12:28791426-28791448 ATGTCCTAGTTCAAGTCTGAAGG - Intergenic
1096005219 12:48164657-48164679 AAGTCCTTGTTTAATCCTGATGG - Intronic
1097237869 12:57552035-57552057 AACTCCTGGATCAACTCTGGAGG + Intronic
1098158681 12:67626240-67626262 AATTCCTGGTCCAAGTCTGAAGG - Intergenic
1098893790 12:76034749-76034771 CACTAAAGGTTTAAGTCTGAGGG + Intergenic
1099072447 12:78063056-78063078 AACTTCTGGTTAAAATGTGATGG + Intronic
1100031780 12:90201443-90201465 AAATCCTGGTCTGAGTCTGAAGG - Intergenic
1100213381 12:92421694-92421716 AACTCCTGGTTTAAGTCTGAAGG - Intronic
1101062432 12:100986160-100986182 AAATCCTGATCCAAGTCTGAAGG - Intronic
1101426724 12:104594297-104594319 AACTCATGTTTGGAGTCTGAGGG - Intronic
1101709477 12:107251485-107251507 AACCACTGGTTTAAGTCTAAGGG + Intergenic
1102482932 12:113236366-113236388 AGCCCCTGGTTGAATTCTGACGG + Intronic
1103238393 12:119393880-119393902 AGGTGCTGGTTAAAGTCTGATGG - Intronic
1103425667 12:120831146-120831168 AACTCCTGATCTGAGTCTGAAGG - Intronic
1105074305 12:133262131-133262153 ACCTCATGGATTAAGTTTGAAGG - Intergenic
1106838755 13:33664068-33664090 AAATCCTGTTTTATCTCTGATGG - Intergenic
1109578149 13:64289286-64289308 TAGTCCAAGTTTAAGTCTGAAGG + Intergenic
1112282286 13:98073528-98073550 AACTCCTCGTTTAAGTTACATGG + Intergenic
1112819804 13:103319106-103319128 AAGTCCCAGTTTGAGTCTGAAGG - Intergenic
1114214390 14:20645075-20645097 GACTCCTGGTATTAGCCTGAGGG + Intergenic
1115759475 14:36564204-36564226 CACTCTTGGTATATGTCTGAAGG + Intergenic
1115787478 14:36842556-36842578 AACTCCTGGTTTATTTGTGAAGG + Intronic
1117458618 14:55922447-55922469 AAGTCCTGGTTGGAGTCTGAAGG + Intergenic
1121677448 14:95765513-95765535 AACCCCTTGTGTAGGTCTGATGG + Intergenic
1123110336 14:105864175-105864197 CTCTCCTGCTTTAACTCTGAAGG - Intergenic
1123715655 15:23028679-23028701 AACTCCTCCGTTAAGTGTGATGG - Intronic
1129121528 15:73400011-73400033 AACTCCTGTTTTAAGTGATAAGG - Intergenic
1132403034 15:101525438-101525460 AACTCCTGGTTTCTGGATGAGGG + Intergenic
1132723710 16:1329725-1329747 AACTCCTGGCTCAATACTGATGG - Intergenic
1134017818 16:10901625-10901647 AACTCCTGGCCCAAGTCTGATGG + Intronic
1134423415 16:14115774-14115796 AACTCCTGGTTTTAGACTTTTGG + Intronic
1135460173 16:22635406-22635428 ATCTCTTTGTTTAATTCTGATGG - Intergenic
1135542422 16:23341948-23341970 AACTCCTGATCTGAGTCTGATGG - Intronic
1140676077 16:77331446-77331468 ATCTCCTGGTTTAAGCAGGAGGG - Intronic
1140771328 16:78206609-78206631 TAATTCTGGTTTAAGACTGAAGG + Intronic
1141241990 16:82273212-82273234 AACTCCTGGCTGGTGTCTGATGG - Intergenic
1141464792 16:84198267-84198289 GAGTCCTGGTCCAAGTCTGAAGG - Intergenic
1141861544 16:86720032-86720054 AAATCCTGGCTTAAGGCTGTAGG + Intergenic
1143164740 17:4892253-4892275 AACGCCTGGGTGAGGTCTGAGGG + Intronic
1144797506 17:17902227-17902249 CACTCCTGGTTAATGCCTGAAGG + Intronic
1144807208 17:17976023-17976045 AACTCCTGGTGCAGGGCTGATGG - Intronic
1146099719 17:29968784-29968806 CCCTCCAGGTTTAATTCTGAGGG - Exonic
1147208388 17:38855618-38855640 AACTCCTGGCTCAATACTGATGG - Intergenic
1147542808 17:41375059-41375081 AAGTCCTGGTTTGAGACTGAAGG - Intronic
1148208682 17:45795155-45795177 ACCTCCTGGCCTCAGTCTGAAGG - Intronic
1150716518 17:67576924-67576946 TACTCCTGTTTTAACTCTGTTGG + Intronic
1152055265 17:78020061-78020083 AATTACTGGCTTAAGTCAGAAGG + Intronic
1157339993 18:46770035-46770057 CACTCCTGGTATAACTGTGAAGG - Intergenic
1158055559 18:53275890-53275912 AAATCCTGCTTTAACTCTAAAGG - Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
925563127 2:5219913-5219935 AACTCCTGCTTTAATTATCATGG + Intergenic
925601807 2:5616072-5616094 AAGTCCTAGTCTGAGTCTGAAGG + Intergenic
925987440 2:9227623-9227645 AGATCCTGGTTAAAGTCTCAGGG - Intronic
929015639 2:37491675-37491697 AACTCCTGTTTTAAGTTTAGGGG + Intergenic
929734030 2:44526544-44526566 AAGTCCTGGTCTGAGTCCGAAGG + Intronic
930348220 2:50213800-50213822 AACTTCTTGTTCAACTCTGAAGG + Intronic
931072074 2:58663181-58663203 AACTCCTGAGATAAGTCTGGGGG + Intergenic
935962185 2:108436766-108436788 AACTTCTCTTTTAAATCTGAAGG + Intergenic
936449325 2:112621839-112621861 AACTCCTGGCTCAATACTGATGG + Intergenic
937037359 2:118793190-118793212 ATCTCCTGGTTGAAGTTTGAAGG + Intergenic
937999844 2:127724105-127724127 AACTTCTGTTTTAAGTCAGAAGG + Intronic
941291997 2:163687910-163687932 AACTCCTGGCTTAACTGTCAGGG - Intronic
942862166 2:180627925-180627947 AACTCCCAGTTTGAGGCTGAAGG + Intergenic
943026694 2:182638021-182638043 AAATCCTGGATAAATTCTGAAGG + Intergenic
944289534 2:197989855-197989877 GACTCCAGGTGCAAGTCTGAGGG - Intronic
945914781 2:215691797-215691819 GTCTCTTGTTTTAAGTCTGATGG - Intergenic
948559135 2:238839016-238839038 ATCTCATGGCTTAAGCCTGATGG - Intergenic
1169015687 20:2290934-2290956 AAACCCAGGTTTAAGTCTCAGGG - Intergenic
1170921340 20:20682622-20682644 AATTCCTGACTTAATTCTGATGG + Intronic
1173446120 20:43120111-43120133 TACTCCTGGTTTAAGAATCAGGG - Intronic
1173661185 20:44734813-44734835 AACTCTGGGTTTTAGTCAGATGG - Intergenic
1174874116 20:54208714-54208736 AAATACTGGTTTTAGCCTGAAGG - Intronic
1175476590 20:59279473-59279495 AACTTCTGGTTGAAGTCCAATGG + Intergenic
952251411 3:31659540-31659562 AAATTCTGGTTTAAGTTTTAAGG - Exonic
952841185 3:37646835-37646857 AACTCCTGATTTTCCTCTGAGGG - Intronic
954097929 3:48345692-48345714 AACTCCTGAATTAAGCATGAAGG + Intergenic
955917297 3:63919471-63919493 AACTCTTGGTTTAAGACTAACGG - Intronic
956449489 3:69359267-69359289 AGCTCCTGGATTAAGACTGGAGG + Intronic
957404818 3:79763894-79763916 AACTCCTTGTTTAAATATGGGGG + Intronic
957532267 3:81455627-81455649 GATTGCTGGGTTAAGTCTGAGGG - Intergenic
959000958 3:100963875-100963897 AACTCTTGAGTCAAGTCTGAAGG - Intronic
962080103 3:132129437-132129459 AAGTCCTGGTCTGAGTCTGAAGG - Intronic
962824678 3:139089207-139089229 AGCTCCTGCCTTAACTCTGAAGG + Intronic
964427106 3:156565482-156565504 AAGTCCTGGTATGAGTCTGAAGG - Intergenic
973030110 4:45326902-45326924 AATTCCTGGTCTGAGTCTGAAGG + Intergenic
974312232 4:60227561-60227583 AACTCTTAGTCTGAGTCTGATGG + Intergenic
980052974 4:128056317-128056339 AACTCCTGGGTTCAGTCTCCTGG + Intergenic
980498431 4:133615634-133615656 AAGTCCCAGTTTGAGTCTGAAGG - Intergenic
981279323 4:142939199-142939221 AGGTCCTGGTCTGAGTCTGAAGG - Intergenic
981766731 4:148259284-148259306 ACCATCTGGTCTAAGTCTGATGG + Intronic
982649270 4:158066149-158066171 ATCTACTGGTTTAACCCTGAAGG + Intergenic
983137219 4:164100686-164100708 AACTCCTATTTTAAGCCTGCTGG + Intronic
983974690 4:173919372-173919394 AATTCTTGGTTTAAGTCCAAAGG - Intergenic
984891736 4:184500047-184500069 AAGTCCTGGTTCAAGTCTGAAGG + Intergenic
988923217 5:35963348-35963370 AATTCCAGGTTTCAGGCTGAGGG - Intronic
989975482 5:50581326-50581348 AAGTCCTGGTTGAAGCCTGAAGG - Intergenic
990393576 5:55353946-55353968 AACTTCTTTTTTAAATCTGAAGG - Intronic
991592470 5:68267500-68267522 AACTTCTAGTTTAAATCTGTCGG + Intronic
994279582 5:97885715-97885737 AACTACTGGATCAACTCTGATGG - Intergenic
994539725 5:101078728-101078750 AAGTCCAGGTTTGAGTCTGAAGG - Intergenic
995127587 5:108593915-108593937 AACTCCTGGCTCAATACTGATGG - Intergenic
995613585 5:113936981-113937003 AACTCTCAGTTTAAGGCTGAAGG + Intergenic
995892893 5:116975925-116975947 AACTTCTGTTTAAAGTTTGAAGG + Intergenic
999483622 5:151971461-151971483 TATTCCTGGGATAAGTCTGAAGG + Intergenic
1002165998 5:177346373-177346395 AACTCCTGGCTCAATACTGATGG - Intronic
1003244268 6:4370924-4370946 AACTCCTAGTCTGAGGCTGAAGG + Intergenic
1003577216 6:7308421-7308443 AACTAGTGGTTTAATTTTGAAGG + Intronic
1004588027 6:17021629-17021651 AACTCCTGGTTTGAAACTCATGG + Intergenic
1010407417 6:75520911-75520933 AAGTCCCAGTTGAAGTCTGAAGG + Intergenic
1010680481 6:78793208-78793230 AATTTTTGGTTTTAGTCTGAAGG - Intergenic
1014136070 6:117891442-117891464 AACTCCCAGTTTGAGGCTGAAGG - Intergenic
1018360778 6:163065393-163065415 GCCTCCTGGTTTCACTCTGATGG - Intronic
1018645874 6:165948215-165948237 AACTCTTGGTTCAGGTCTCAAGG - Intronic
1019048351 6:169164808-169164830 AACCCCTGGTTTAAATCATAAGG + Intergenic
1019274337 7:167979-168001 AGCGCCTTGTCTAAGTCTGAGGG + Intergenic
1019398490 7:836553-836575 ATGTTCTGGTTTGAGTCTGAAGG + Intronic
1022050330 7:26662228-26662250 AGCTCCTGAATTAAGTGTGAGGG - Intergenic
1022370032 7:29761798-29761820 AAATCCTGGTTCAAGTCTGAAGG - Intergenic
1025106751 7:56176866-56176888 AACTCCAGGTTTAAATCTGAAGG + Intergenic
1026311518 7:69189504-69189526 AACTCCTGGTTTAAATCTGAAGG - Intergenic
1032564371 7:132926432-132926454 AGCTGCTGGTTTATATCTGATGG + Intronic
1034891500 7:154843441-154843463 AGGTTCTGGTCTAAGTCTGAGGG - Intronic
1035496630 7:159333376-159333398 ACCTCATGGATTAAGTTTGAAGG - Intergenic
1036397966 8:8385070-8385092 AACTTCTGATGTAAGTCTGAGGG - Intronic
1036484754 8:9169380-9169402 AACTCCCAGTCTAAGGCTGAAGG - Intergenic
1039035449 8:33354384-33354406 AAGCCCCGGTTTGAGTCTGAGGG + Intergenic
1040955303 8:52973967-52973989 GACTCCCAGTTTAAGGCTGAAGG - Intergenic
1041266754 8:56073120-56073142 AACTCCTGGCTCAATACTGATGG + Exonic
1041334086 8:56760286-56760308 AACTTCTGGCTGACGTCTGAGGG - Intergenic
1041849389 8:62372135-62372157 AATTCCTTGTTAAAATCTGATGG - Intronic
1042927609 8:73982422-73982444 AACTCCTGGCTCAATACTGATGG - Exonic
1046175156 8:110566150-110566172 AAATTCTGCTTTAAATCTGAAGG + Intergenic
1049809881 8:144561719-144561741 AACCACTGGATTAAGTCCGATGG - Intronic
1049809885 8:144561743-144561765 AACCACTGGATTAAGTCCGATGG - Intronic
1051478743 9:17537185-17537207 AACTCTGGGTTTAATTCTGTTGG + Intergenic
1053398722 9:37799629-37799651 AACTCCCGGTCCAAGACTGAAGG + Intronic
1055120574 9:72655862-72655884 AACTCCTGGCTCAATACTGATGG + Intronic
1055424550 9:76180714-76180736 AATTCCTGCTGTAAGTCTGCTGG + Intronic
1055581689 9:77712725-77712747 AACTCCTGGTTTTTGGCTGGTGG + Intergenic
1056416962 9:86386203-86386225 AAACCCTGGTTTAAGGCTTATGG - Intergenic
1060253099 9:122001866-122001888 AACTGCTGGTTTAAATTTCAAGG + Intronic
1061792238 9:133064819-133064841 TACTCCTGGCTTGAGTCTGGGGG + Intronic
1062685318 9:137809771-137809793 AACACTTGGTTTATGTCTGTTGG - Intronic
1186728844 X:12386147-12386169 AACACCTGGTTTCACTCTGAAGG - Intronic
1192790120 X:74373304-74373326 AACTCCTGTTATAAGTCTCTAGG - Intergenic
1194186897 X:90781790-90781812 AAATCCCAGTTCAAGTCTGAAGG + Intergenic
1194201259 X:90955410-90955432 CACTACTGGTTTAGGTATGAGGG + Intergenic
1194831375 X:98626335-98626357 AAAGACTGGTTTAAGTCAGAGGG + Intergenic
1194870974 X:99130522-99130544 AAGTCTTGGTTCAAGTCTGAAGG - Intergenic
1200533488 Y:4363864-4363886 AAATCCCAGTTCAAGTCTGAAGG + Intergenic
1200547103 Y:4530866-4530888 CACTACTGGTTTAGGTATGAGGG + Intergenic
1201894469 Y:18978874-18978896 AACTCCTGAATTAATTCTGCAGG - Intergenic
1202298931 Y:23389887-23389909 AACTCCTGGTTTACCTAAGATGG + Intergenic
1202571878 Y:26280711-26280733 AACTCCTGGTTTACCTAAGATGG - Intergenic