ID: 1100218869

View in Genome Browser
Species Human (GRCh38)
Location 12:92482354-92482376
Sequence GTCTTGCTGGACCAGGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100218869_1100218875 21 Left 1100218869 12:92482354-92482376 CCAAGACCCTGGTCCAGCAAGAC 0: 1
1: 0
2: 4
3: 14
4: 134
Right 1100218875 12:92482398-92482420 ATAGCCACCAACTTCACAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100218869 Original CRISPR GTCTTGCTGGACCAGGGTCT TGG (reversed) Intergenic
900157987 1:1211215-1211237 CTCTGGCTGGACAGGGGTCTTGG - Intergenic
900245589 1:1634712-1634734 CTCTCGGTGGACCAGGGGCTGGG - Intronic
900256818 1:1701869-1701891 CTCTCGGTGGACCAGGGGCTGGG - Intronic
901664680 1:10819579-10819601 GTATTGCTGAATCAGGGTGTGGG + Intergenic
902781911 1:18710452-18710474 GTCTTGCTGGACCAGGGACGAGG + Intronic
902874292 1:19331674-19331696 GTCTCGCTCCACCTGGGTCTGGG + Intergenic
903668992 1:25024520-25024542 GTCTTGGGGGTCCAGGGTCTTGG + Intergenic
904814034 1:33181964-33181986 GTCGCGCTGGGCCAGGGTTTGGG - Intronic
907298777 1:53472123-53472145 GTCTTGGTGGGCCTGGGCCTAGG + Intergenic
910660626 1:89668193-89668215 GTTTTGCTGCACCAAGTTCTTGG + Intronic
916332555 1:163633907-163633929 CTGCTGCTGCACCAGGGTCTCGG + Intergenic
918148069 1:181775272-181775294 GTATTTCTGGCCCAGGTTCTTGG - Intronic
919925187 1:202188506-202188528 GTGTTGCTGGACAATGGTCTTGG + Intergenic
923087385 1:230711887-230711909 GTGGTGCTGGACCCGTGTCTAGG - Intronic
923668621 1:236020887-236020909 GTCTTTCTGGACAAGGATATCGG + Intronic
923973106 1:239227219-239227241 TTCTTCCTGGAGCAGGGTTTGGG + Intergenic
1069713842 10:70508271-70508293 ATCTTACTGGACCAGGGGGTGGG - Intronic
1069872242 10:71540260-71540282 TGCTTTCTGGTCCAGGGTCTGGG - Intronic
1070389765 10:75959248-75959270 GGCTTGCTGCACCAGGGACCTGG - Intronic
1070418047 10:76208552-76208574 TGCTGGCTGGACCAGGCTCTGGG - Intronic
1070807200 10:79277601-79277623 CTCTTTCTTGACCAGGGTATTGG + Intronic
1074879945 10:117647944-117647966 GTCTTCCTGCTGCAGGGTCTGGG + Intergenic
1077116112 11:885347-885369 GTCTACCAGGACCAAGGTCTGGG + Intronic
1077430302 11:2512899-2512921 GTTTTCCTGGCCCAGGGTCTTGG + Intronic
1078064206 11:8067254-8067276 TTCTTGCTGAGTCAGGGTCTAGG + Intronic
1078845512 11:15115589-15115611 ATCTGGCTAGACCAGGGTCAGGG + Intronic
1079158537 11:17971619-17971641 CTCTTGAGTGACCAGGGTCTTGG - Intronic
1079304456 11:19310011-19310033 GCCTGGCTGGACCAGGGGTTGGG + Intergenic
1079453411 11:20617180-20617202 GTTTTGCTTGAGCAAGGTCTAGG + Intronic
1081402706 11:42661615-42661637 GCCTTGCTCTACCATGGTCTGGG - Intergenic
1082960612 11:58915551-58915573 ATCTTGCTGGCCCAGGGGCCAGG - Intronic
1083299576 11:61733317-61733339 GTGGTGATGGGCCAGGGTCTAGG - Intronic
1084180122 11:67441932-67441954 GACTGGCTGGGCCAGGGTCGTGG - Intronic
1084394145 11:68897866-68897888 GGCTGACTGGAGCAGGGTCTAGG + Intronic
1087172044 11:95059067-95059089 GCCTTCCTGGACCAGCGGCTTGG - Intergenic
1089582346 11:119489300-119489322 GTCCTGATGGACCAGGGTGGGGG + Intergenic
1090206784 11:124888947-124888969 CTCTTGGTGGACCAGGGACCAGG + Intronic
1091650786 12:2307608-2307630 ATCTTGAAGGGCCAGGGTCTTGG + Intronic
1096183709 12:49565182-49565204 CTCTTGCTGGTGCAGTGTCTAGG + Intronic
1096587344 12:52631428-52631450 GTCTTGCTGGTCCTGGGTCAGGG - Intergenic
1098213019 12:68186192-68186214 GTCCTGCTCCCCCAGGGTCTTGG - Intergenic
1100218869 12:92482354-92482376 GTCTTGCTGGACCAGGGTCTTGG - Intergenic
1101748309 12:107561208-107561230 ACCTTGCTGCCCCAGGGTCTGGG - Intronic
1101827136 12:108229171-108229193 GTCCTGGTGGGCCAGGCTCTTGG - Intronic
1102177518 12:110886846-110886868 GTCTTCCTGGACAAGGGTCCAGG + Intronic
1110027654 13:70562036-70562058 GTACTACTGGATCAGGGTCTTGG - Intergenic
1110256283 13:73437279-73437301 GGCTTCCTGGGGCAGGGTCTTGG + Intergenic
1113820360 13:113209001-113209023 GCCTGGCTGGGCCAGGGCCTCGG + Intronic
1118498514 14:66333418-66333440 GTCTGGATGCACCAGGGTCAGGG - Intergenic
1121223332 14:92302785-92302807 TTCTTGGAGGACCAGGGGCTGGG + Intergenic
1122428987 14:101628093-101628115 GTCTTGCAGCTCCTGGGTCTGGG + Intergenic
1122953964 14:105061343-105061365 GCCTTCCTGGACCAGGGTCCGGG + Intronic
1125003825 15:34796282-34796304 GTCTTGCTGGAGAAGGGACCAGG + Intergenic
1125600184 15:40911335-40911357 GTCTGGCTGGCCCTGGGTGTGGG - Intergenic
1126688384 15:51267596-51267618 GTCTTCCTGGGACAGGTTCTGGG - Intronic
1128342641 15:66833477-66833499 GTCTTGCTGGGCCAGGCTCTAGG - Intergenic
1129253616 15:74321803-74321825 ATCTGGCAGGAGCAGGGTCTGGG + Intronic
1130045357 15:80440051-80440073 GTCTTGGTAGGCCAGAGTCTAGG + Intronic
1130791430 15:87160140-87160162 GGCTTCATGGAACAGGGTCTAGG + Intergenic
1130950856 15:88586457-88586479 GTCTTGTTGCTCCAGGCTCTGGG - Intergenic
1132353965 15:101157943-101157965 CCCTTGCTGCACCAGGCTCTGGG - Intergenic
1133051150 16:3118306-3118328 GGCTTGCTGGCCCAGGCACTGGG - Intronic
1133818612 16:9216721-9216743 GTCTGGCTGGACCAAGGAGTTGG + Intergenic
1136460624 16:30407960-30407982 GCCTTGCTGGGCCAGGGCCACGG + Intronic
1138149917 16:54647383-54647405 TTGTTCCTGGACCAGAGTCTTGG + Intergenic
1138652421 16:58468278-58468300 GTCTTGCTGCAACAGGGACAAGG + Intronic
1144760434 17:17704058-17704080 GGCTTGATGGGCCAGGGCCTGGG + Intronic
1144780460 17:17805712-17805734 GGCTTGCTGGAGCAGGGACGTGG + Intronic
1144788824 17:17846375-17846397 GTCTGGCTGGACCAGGGCCTGGG + Intronic
1148523676 17:48308137-48308159 ATCTTAGTGTACCAGGGTCTTGG - Intronic
1148535287 17:48433510-48433532 ATCTTGCTGGAATTGGGTCTGGG - Intergenic
1148700831 17:49585828-49585850 GTCCTGCAGGGGCAGGGTCTTGG - Intergenic
1151348972 17:73520340-73520362 CCCTTGCTGGACCAAGGTCAAGG + Intronic
1152009660 17:77704425-77704447 CTCTTCCTGGAACAGGGGCTTGG - Intergenic
1155154552 18:23147805-23147827 GTCTTCCTGGGCCTGGGTGTGGG - Intronic
1157566417 18:48681691-48681713 GTGCTGCTGGATCAGGGGCTTGG - Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
925112323 2:1346954-1346976 GTCATGCTGTACCAGAGTCAGGG + Intronic
927472081 2:23384826-23384848 GCCTTGCTGGCCCAGGGTTGGGG - Intergenic
931495492 2:62802286-62802308 GTCTTGCTGGAGGAGGGGCAGGG + Intronic
932691564 2:73917919-73917941 GACTTGTTGGACCAGAATCTGGG - Intronic
934512074 2:94953437-94953459 CACTTGCTGGACCTGGGACTGGG + Intergenic
935391328 2:102556191-102556213 GTCCTGGTGGAACAGGGTCCAGG + Intergenic
936147135 2:109987463-109987485 GTCGGGCTGGACAGGGGTCTCGG + Intergenic
936197557 2:110384020-110384042 GTCGGGCTGGACAGGGGTCTCGG - Intergenic
936247119 2:110837921-110837943 GCCTGGCTGGGCCAGGGTCAGGG + Intronic
937054007 2:118915604-118915626 GACTTGATGGCCCAGGGTCAGGG + Intergenic
937288488 2:120767754-120767776 GGCTTGCTGGACAAGCGCCTGGG - Intronic
937517324 2:122670214-122670236 GTCTCTCTGGACCAGGCACTGGG + Intergenic
938590058 2:132727760-132727782 GTCCTGCTGGACCATGTTCAGGG - Intronic
940887242 2:159000528-159000550 GTCTTTCGGGCCCAGGGTATAGG + Intronic
942423511 2:175834534-175834556 GTCTGGTGGGACCAGGGTTTGGG - Intergenic
946322068 2:218960095-218960117 GCGTTGCTGGACCAGGGGGTCGG - Exonic
946895485 2:224319378-224319400 GGCTTCATGGACCAGGGACTAGG + Intergenic
947915369 2:233828908-233828930 GTCTTGCTGGAGAAGTGCCTGGG + Exonic
1168805389 20:669656-669678 TTCTTGCTGTGCCAGGGCCTCGG + Intronic
1169068645 20:2708323-2708345 GGGTTGCGGGAACAGGGTCTGGG + Intronic
1171367266 20:24633794-24633816 GTCCTAATGGACCAGGCTCTTGG + Intronic
1171406478 20:24915304-24915326 CTGTGGCTGGAGCAGGGTCTGGG - Intergenic
1171418574 20:25000749-25000771 GAATTGCTGGACCAGGATCTGGG + Intergenic
1172844748 20:37923227-37923249 TTCATGCTGAACCAGGGTCTGGG + Intronic
1172950140 20:38718067-38718089 ATCCTGCTGGACCATGATCTGGG - Intergenic
1174292657 20:49519888-49519910 GTGCTGCTGGGCCAGGGTCAGGG - Intronic
1179885403 21:44312172-44312194 GCCGTGCTGGACCAGGTTGTAGG - Exonic
1180193545 21:46180871-46180893 GTCTTGCTGGACACGGGTCTTGG - Intronic
1182445328 22:30386613-30386635 CACCTGCTGGACCAGGGCCTTGG + Exonic
1183347583 22:37316467-37316489 GCCTTGTTGTACCAGTGTCTGGG - Intergenic
1184393064 22:44216724-44216746 GTCTGGCTGGATCAGGGGCTGGG - Intronic
1184894563 22:47399581-47399603 CTCTTGCTGGCCCAGGGCCTCGG + Intergenic
949849241 3:8405335-8405357 GTCTCACTGGACCAAAGTCTAGG - Intergenic
950018462 3:9769934-9769956 CTCTTGCTGGAGCTGGGGCTCGG + Exonic
953909489 3:46884477-46884499 CTCCTCCTGGGCCAGGGTCTGGG + Intronic
955190246 3:56755084-56755106 GCATTTCTGGACCAGGGTCGGGG + Exonic
964356195 3:155854077-155854099 GTCGCGCTGGACCAGGGTTTCGG + Exonic
965657477 3:171003786-171003808 GAATTGCTGGACCATGGTGTAGG + Intronic
969302750 4:6306991-6307013 GGCTTGCTGGGCCAGGCTCTCGG - Intergenic
975817638 4:78235607-78235629 GCCTTGCTGGACCAGACTGTGGG - Intronic
980954448 4:139414232-139414254 TTCTATCTGGACAAGGGTCTGGG + Intronic
985050866 4:185989512-185989534 GTATTGCTGGACCAGGAACCTGG - Intergenic
986616341 5:9621220-9621242 GTCTTGCTTGACCATGGCCACGG + Intergenic
989242759 5:39219487-39219509 ATCTTCCTGGGCCAGGGTCTGGG + Exonic
991642606 5:68769925-68769947 GTCATCCTGGAGCAGGGCCTTGG - Intergenic
994728268 5:103462062-103462084 TTCTTCCTGGGACAGGGTCTTGG + Intergenic
998498228 5:142609528-142609550 GGCTTGCTGCACCTGTGTCTGGG + Intronic
998989477 5:147799911-147799933 TTGTTGCTGGACCAGGGCCAGGG - Intergenic
999105868 5:149070441-149070463 GTGTGGCTGGACCAGGGGGTTGG + Intergenic
999225978 5:150024926-150024948 GTCTTGCTGGTATAGGCTCTGGG + Intronic
999502655 5:152162349-152162371 GTATGGCTGGATCAGGGACTGGG - Intergenic
1002106317 5:176881017-176881039 GCCTTGCTGGAGCCGGGTCGGGG - Exonic
1006113341 6:31762011-31762033 GTCCTACTGGGCCTGGGTCTAGG + Intronic
1007818859 6:44545066-44545088 GCCTTGCTGGCCCAGGGCATGGG + Intergenic
1015786823 6:136927309-136927331 GTCAGGGTGGACCAGAGTCTTGG - Intergenic
1027190768 7:75994428-75994450 GTCTCGCTGGCTCAGGGTCAAGG - Intronic
1028466972 7:91163278-91163300 GTCTTGCTGGTCCAGGCAGTTGG + Intronic
1030533323 7:110736422-110736444 GCTCTGCTGGTCCAGGGTCTTGG - Intronic
1032112818 7:129091331-129091353 GTCCTTCTGGACCAGGGTCACGG - Intergenic
1032513007 7:132486881-132486903 GCCTTGCTGGCCCAGGCTCCTGG + Intronic
1036077214 8:5515157-5515179 ATCTTGCTGGTCCATGGTGTTGG + Intergenic
1048396713 8:134020851-134020873 GTCTTGCTGGCTCAGGTCCTTGG + Intergenic
1049183155 8:141233820-141233842 GTTTTGCTGGTGCAGGGCCTTGG + Intronic
1049745310 8:144260755-144260777 GTCTTCCTGGACCAGGTGGTGGG + Exonic
1053043067 9:34891109-34891131 GGCTTCCTGGGACAGGGTCTGGG + Intergenic
1053301564 9:36955669-36955691 GTCCTGGTGGCCCAGGGTATGGG - Intronic
1053364914 9:37516005-37516027 GTTTTCCTGCACCAGGGCCTTGG + Exonic
1057045068 9:91879238-91879260 GTCTTCCTGGGCCAGGCCCTTGG - Intronic
1057075817 9:92137688-92137710 GTGTTGTTGGACAATGGTCTTGG + Intergenic
1060235577 9:121860341-121860363 GTCCCGCTGGTCCAGGGTCATGG + Exonic
1061828999 9:133278665-133278687 GTCTCCCTGGACCTGGGTTTGGG - Intergenic
1062107468 9:134763799-134763821 CTCCTGCTGGAGCAGGATCTGGG + Intronic
1188290066 X:28376679-28376701 GTCTTGTGGGACCAGGGCCAGGG - Intergenic
1190058777 X:47197705-47197727 GCCTTGCTGGGTCAGGGTCATGG + Intronic
1194553463 X:95330146-95330168 TTCTTGGTGCACCTGGGTCTGGG - Intergenic
1195084193 X:101398800-101398822 ATGTTGCTGGACCAGGGGGTTGG - Exonic