ID: 1100220544

View in Genome Browser
Species Human (GRCh38)
Location 12:92500403-92500425
Sequence AGATGTACCCTGGTGTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100220541_1100220544 11 Left 1100220541 12:92500369-92500391 CCTAAACTGTGTGCATGGGAATT No data
Right 1100220544 12:92500403-92500425 AGATGTACCCTGGTGTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100220544 Original CRISPR AGATGTACCCTGGTGTTGAG TGG Intergenic
No off target data available for this crispr