ID: 1100220972

View in Genome Browser
Species Human (GRCh38)
Location 12:92504355-92504377
Sequence CCCTGTGTATGGAGCTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100220972_1100220978 -10 Left 1100220972 12:92504355-92504377 CCCTTTGAGCTCCATACACAGGG No data
Right 1100220978 12:92504368-92504390 ATACACAGGGGCAGCCTAACGGG No data
1100220972_1100220979 -5 Left 1100220972 12:92504355-92504377 CCCTTTGAGCTCCATACACAGGG No data
Right 1100220979 12:92504373-92504395 CAGGGGCAGCCTAACGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100220972 Original CRISPR CCCTGTGTATGGAGCTCAAA GGG (reversed) Intergenic
No off target data available for this crispr