ID: 1100222726

View in Genome Browser
Species Human (GRCh38)
Location 12:92523533-92523555
Sequence GGATTGTATTGATAAGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100222726_1100222735 23 Left 1100222726 12:92523533-92523555 CCTAGACCTTATCAATACAATCC No data
Right 1100222735 12:92523579-92523601 TAGGTATGAAACTTTAATCATGG No data
1100222726_1100222730 4 Left 1100222726 12:92523533-92523555 CCTAGACCTTATCAATACAATCC No data
Right 1100222730 12:92523560-92523582 TCCTTTCCCTTCTCTCCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100222726 Original CRISPR GGATTGTATTGATAAGGTCT AGG (reversed) Intergenic
No off target data available for this crispr