ID: 1100223971

View in Genome Browser
Species Human (GRCh38)
Location 12:92537898-92537920
Sequence TGCTGTGCATGAAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100223971_1100223976 19 Left 1100223971 12:92537898-92537920 CCAGCTTCCCTTCATGCACAGCA No data
Right 1100223976 12:92537940-92537962 CCGTACATGTCTAGCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100223971 Original CRISPR TGCTGTGCATGAAGGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr