ID: 1100226712

View in Genome Browser
Species Human (GRCh38)
Location 12:92564509-92564531
Sequence GGGTGTGCATAATTTCCCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100226712_1100226717 18 Left 1100226712 12:92564509-92564531 CCTACGGGAAATTATGCACACCC No data
Right 1100226717 12:92564550-92564572 CGTCTCTGACCAAAAGAACTGGG No data
1100226712_1100226716 17 Left 1100226712 12:92564509-92564531 CCTACGGGAAATTATGCACACCC No data
Right 1100226716 12:92564549-92564571 TCGTCTCTGACCAAAAGAACTGG No data
1100226712_1100226718 25 Left 1100226712 12:92564509-92564531 CCTACGGGAAATTATGCACACCC No data
Right 1100226718 12:92564557-92564579 GACCAAAAGAACTGGGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100226712 Original CRISPR GGGTGTGCATAATTTCCCGT AGG (reversed) Intergenic
No off target data available for this crispr