ID: 1100239274

View in Genome Browser
Species Human (GRCh38)
Location 12:92694553-92694575
Sequence CTGTGTTGGGGGAAGGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100239264_1100239274 29 Left 1100239264 12:92694501-92694523 CCAATCACATGCAGATAGAGTGA No data
Right 1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100239274 Original CRISPR CTGTGTTGGGGGAAGGGAAA AGG Intergenic
No off target data available for this crispr