ID: 1100244144

View in Genome Browser
Species Human (GRCh38)
Location 12:92739520-92739542
Sequence AAGCTTGGACAGCTTACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100244144_1100244147 8 Left 1100244144 12:92739520-92739542 CCCACTGTAAGCTGTCCAAGCTT 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1100244147 12:92739551-92739573 GACATTTCCTGTTTAAGAAAAGG 0: 1
1: 0
2: 3
3: 49
4: 854

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100244144 Original CRISPR AAGCTTGGACAGCTTACAGT GGG (reversed) Intronic
901258488 1:7853753-7853775 CAGCTTGGGCAGAGTACAGTTGG - Intergenic
906020786 1:42627720-42627742 AAGCTTTGACAGCTTCCATGTGG + Intronic
908319462 1:62966020-62966042 AAGATTAGAAAGCATACAGTTGG + Intergenic
908715734 1:67067725-67067747 AAGCTTTGGCAGCTTACACATGG + Intergenic
908729197 1:67208567-67208589 AAGCTTTGACAGCTTCCACATGG + Intronic
909574549 1:77159203-77159225 AAGCCTGGGCAGCTTACACATGG + Intronic
912400058 1:109383041-109383063 AAGCTTGGAAAATTTAAAGTTGG + Intronic
915291221 1:154884915-154884937 AAGCAAGGACAGCTTTCAGAAGG - Intergenic
915436406 1:155910008-155910030 AAGCCTGGACATCTTGCACTTGG - Intronic
917923957 1:179773627-179773649 AACCTTGGACTGCTTACAGCGGG - Intronic
918886245 1:190198056-190198078 AAGCCTTGGCAGCTTACAGGTGG - Intronic
919631550 1:199964843-199964865 AGGCTTGGGTAGCTTGCAGTAGG - Intergenic
921343704 1:214159892-214159914 AAGGTTGGACAACTTGAAGTGGG - Intergenic
922004204 1:221512242-221512264 AAGGTTTAAAAGCTTACAGTTGG - Intergenic
922510138 1:226158809-226158831 AGGCTTGGACAGCCTCCAGTGGG - Intronic
924284507 1:242471864-242471886 AAACTGGGATAGCTAACAGTAGG - Intronic
1064259906 10:13777054-13777076 AAGCTTGGAGACGTTACAGGAGG + Intronic
1068352175 10:55862093-55862115 AAGCCTTGACAGCTTACACATGG + Intergenic
1070573291 10:77657921-77657943 AAGGTGGGACAACTTAAAGTGGG + Intergenic
1071427324 10:85571952-85571974 AAGCTCAGACAGCTTAAACTGGG + Intergenic
1075786602 10:125054096-125054118 CAGCTTGGAAAGCTCTCAGTGGG - Intronic
1076004297 10:126935701-126935723 ATGCTGGGACAGCTCAGAGTAGG - Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1077993318 11:7431781-7431803 AAGCTTGGGCAGCTTCCATGTGG + Intronic
1079285755 11:19130632-19130654 AAGCTTAGATAACTTACTGTAGG + Intronic
1081349125 11:42027028-42027050 AAGCTTTGGCAGCTTACACATGG - Intergenic
1086669276 11:89527640-89527662 AAGCCTTGGCAGCTTACATTTGG + Intergenic
1088048374 11:105480536-105480558 AAGCTTCGGCAGCTTCCACTTGG + Intergenic
1090313880 11:125767928-125767950 AAGGCAGGACAGCTTAAAGTGGG + Intergenic
1091492661 12:946773-946795 TAGCTGGGAAAGCATACAGTGGG + Intronic
1091529694 12:1342090-1342112 AAGTATGAACAGCTTTCAGTGGG + Intronic
1094134639 12:27111270-27111292 AATCTTGGACAGTTAAAAGTTGG + Intergenic
1094184758 12:27629061-27629083 AATCTTGGACAGTTAAAAGTTGG + Intronic
1094644748 12:32311539-32311561 AAGGTGGGACAGCTCACAGCGGG + Intronic
1095166833 12:38982996-38983018 GAACTTGGACAACTCACAGTCGG - Intergenic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1100244144 12:92739520-92739542 AAGCTTGGACAGCTTACAGTGGG - Intronic
1101087417 12:101250464-101250486 AAGATTGCCCAGCTAACAGTTGG + Intergenic
1102758754 12:115366988-115367010 AAGCCTTGACAGCTTCCAGATGG + Intergenic
1103919596 12:124392608-124392630 AAGCTGCCAGAGCTTACAGTGGG - Intronic
1104130579 12:125889892-125889914 ATGCTGGGACAGCTCACAGTGGG + Intergenic
1110834466 13:80067559-80067581 AAGTTCGCACAGCTTAGAGTTGG + Intergenic
1110848304 13:80215092-80215114 GAGTATGGACAGATTACAGTGGG + Intergenic
1112556922 13:100477674-100477696 AAGTTTGGACAGTATACGGTAGG + Intronic
1114509985 14:23250823-23250845 AAGGTGGGACAGCTCAAAGTGGG + Intronic
1115824341 14:37250086-37250108 ATGCATAGACAGTTTACAGTAGG + Intronic
1119070812 14:71581899-71581921 AAGTTGGGACAGCTTAAAGTAGG - Intronic
1125992821 15:44126767-44126789 AAGATTGGTCAGCTGAGAGTGGG - Intronic
1128325012 15:66718666-66718688 AAGCTGGAAAAGCTAACAGTGGG - Intronic
1132284204 15:100648695-100648717 AAGCTTGGACCTCTTAAACTTGG - Exonic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1143141009 17:4741776-4741798 AAGCCCCGACAGCTTACTGTGGG + Exonic
1144279301 17:13708881-13708903 AAGCTTGGACAACTTTCATTGGG - Intergenic
1148237571 17:45979334-45979356 AAGCTTCCACATTTTACAGTAGG - Intronic
1150916476 17:69442760-69442782 AAGGTTACACAGCTTACAATTGG - Intronic
1150956552 17:69866540-69866562 AAGGTAGGACAGCTTAAAGGAGG - Intergenic
1150987400 17:70213831-70213853 AAGCCTTGACAGCTTACATGTGG + Intergenic
1152996981 18:416837-416859 AAGCTTGGCAAGCTAACAGGTGG + Intronic
1153512206 18:5868441-5868463 GACCTTGGACAGCTCACAGAGGG - Intergenic
1156784398 18:40892970-40892992 AAGCCTTGGCAGCTTACAGGTGG + Intergenic
1159555499 18:69941048-69941070 AAGCCTTGACAGCTTACACGTGG + Intronic
1164396476 19:27868353-27868375 ATGCTGGGACAGTTCACAGTAGG - Intergenic
927396190 2:22654474-22654496 AAGCTTTGGCAGCTTACACATGG + Intergenic
928194983 2:29209202-29209224 GAGCATGGCCAGATTACAGTTGG + Intronic
930939771 2:56999139-56999161 AAGCCTTGACAGCTTACACATGG - Intergenic
931112097 2:59122272-59122294 AAACTTGAACAGCCTAAAGTAGG - Intergenic
935219998 2:101004007-101004029 AAGTTTTTACAGCATACAGTAGG - Intronic
935385232 2:102492461-102492483 AAGCTTTGGCAGCTTACACATGG - Intronic
939818511 2:146926904-146926926 AGGGTTGGAGAGCTTGCAGTAGG - Intergenic
943009633 2:182431732-182431754 AAGCTTTTACTCCTTACAGTAGG + Intronic
944399302 2:199307297-199307319 AAGGTTGGAAAGCCTACATTGGG + Intronic
1168977749 20:1980794-1980816 GAGCTTGGCCAGCTCACTGTAGG + Exonic
1174305124 20:49609613-49609635 AAGCTTGCACAGCTTGTAGGTGG + Intergenic
1176315299 21:5237115-5237137 AAGCCTTGGCAGCTTACATTAGG + Intergenic
1180393084 22:12303070-12303092 AAGCCTTGACAGCTTACATGAGG + Intergenic
1182808976 22:33099674-33099696 GGGCTTGGACAGCTTGAAGTTGG + Intergenic
956474952 3:69610001-69610023 AAGCTTTGACAGCTTCCACATGG + Intergenic
959929124 3:111959313-111959335 AAGCTAGGCCAGGTGACAGTGGG + Intronic
962374875 3:134851220-134851242 AAGCTTGCATAGCATAAAGTAGG - Intronic
965440226 3:168703571-168703593 AAACTGGAGCAGCTTACAGTGGG - Intergenic
965606424 3:170502004-170502026 AAGCTTACACAGCCTACAGTGGG - Intronic
966047762 3:175573692-175573714 AAGCTGGGACAGTTTAGAGAGGG - Intronic
969918202 4:10510843-10510865 AAGGTGGGACAGCTTGAAGTGGG - Intronic
971670258 4:29546767-29546789 AAGCTTTGACAGCTTCCATGTGG - Intergenic
971744836 4:30566374-30566396 AAGCCTGGGCAGCTTACATGTGG + Intergenic
971793665 4:31199702-31199724 AAGCTTTGGCAGCTTACACGTGG - Intergenic
971889871 4:32506785-32506807 AAGCTTTGACAGCTTCCACGTGG + Intergenic
973536269 4:51885426-51885448 CAGCTGGGACAGCATACAGGAGG + Intronic
975038150 4:69710222-69710244 AAGCCTTGGCAGCTTACAGGTGG - Intergenic
975474212 4:74804252-74804274 AAGCTGGGTCAGCTTACTATAGG + Intergenic
977564238 4:98565625-98565647 AAATTTGGACTGCTTAAAGTAGG + Intronic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
978063120 4:104363717-104363739 AAACTTTGATAGCTCACAGTGGG - Intergenic
979636302 4:122958242-122958264 AAGCTTGGAAATCTGTCAGTGGG - Intronic
979862730 4:125714698-125714720 AATCTTGGATTGCTTACTGTTGG + Intergenic
981695233 4:147552924-147552946 AAGCCTTGACAGCTTACACATGG + Intergenic
982597419 4:157404139-157404161 AAGCTTTGGCAGCTTACATGTGG - Intergenic
985346679 4:189013064-189013086 ACACTTGGACAGCTTTAAGTTGG + Intergenic
987065316 5:14284540-14284562 GAGCTTGCACAGTTTACAGAAGG - Intronic
987098189 5:14568297-14568319 AAGCTTGTCCAACTCACAGTAGG + Intergenic
987610670 5:20198898-20198920 AAGCTTTGACAGCTTCCACATGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
999418173 5:151418047-151418069 AAGCATGGACAGCTTAAATGTGG + Intergenic
1000600981 5:163274159-163274181 AAGGAGGGACAGCTTGCAGTGGG + Intergenic
1001903376 5:175450230-175450252 ATGCATGGACTGCTTGCAGTTGG + Intergenic
1001999268 5:176188358-176188380 AACCTTCGACAGGTTACAGGAGG + Intergenic
1004987933 6:21103800-21103822 ATGCTTGGAGAGCTAACAGGTGG + Intronic
1007191322 6:40021334-40021356 GAGTTTGGACAGCTGCCAGTAGG - Intergenic
1009908163 6:69893967-69893989 AAGGTGGGACAACTTAAAGTGGG - Intronic
1010147054 6:72682544-72682566 GAACTTGGACAGCTAAGAGTGGG - Intronic
1016530867 6:145057093-145057115 AAGCTTTGACAGCCAAAAGTGGG + Intergenic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019348020 7:539949-539971 AAGCCTGGCCAGGTTCCAGTGGG + Intergenic
1020408886 7:7868132-7868154 CTGCCTGGACAGCTTACGGTTGG + Intronic
1023340940 7:39218798-39218820 AATCATGGTCAGCTTAAAGTAGG - Intronic
1024678414 7:51658866-51658888 AAGCAGGGACTGCTAACAGTGGG + Intergenic
1027506357 7:79021051-79021073 AAGCCTTGTCAGCTTACAGGTGG + Intronic
1029047465 7:97645327-97645349 AAGCTTTGAGAGCTTCCACTTGG + Intergenic
1030459047 7:109808033-109808055 AAGCCTGGACAGCTTCCATGTGG + Intergenic
1031771325 7:125848054-125848076 AAGCCTTGACAGCTTACATGTGG + Intergenic
1032985036 7:137328430-137328452 AAGCTTGGACATCCAACAGTGGG - Intronic
1033156637 7:138962549-138962571 CAGCTTGGACTTCTTATAGTAGG - Intronic
1037138916 8:15496500-15496522 AAGCTAGGACAGCATACAAGGGG - Intronic
1038880467 8:31605490-31605512 AAGCTTTGACAGCTTCCATGTGG - Intergenic
1039700869 8:39960460-39960482 AAGCTTGAGCAGTTTATAGTTGG - Intronic
1041759086 8:61344636-61344658 ATGCTTGGACAGCTGAGATTAGG - Intronic
1042184489 8:66123224-66123246 AAGATGGGACAGCTCAAAGTGGG - Intergenic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042722867 8:71843741-71843763 CAGCTTGGAGAGCTTAGTGTCGG + Exonic
1042989259 8:74620556-74620578 AAGCTTTGGCAGCTTACACATGG - Intronic
1043062214 8:75518592-75518614 AAACTTTGGCAGCTTACAGGTGG - Intronic
1044098192 8:88095917-88095939 AAGTTTGAACAAGTTACAGTTGG - Intronic
1049037631 8:140089131-140089153 AAACTTGTACAGCCCACAGTGGG - Intronic
1049746928 8:144266933-144266955 AATCTTGGAGAGCTTGCGGTCGG - Exonic
1052614517 9:30821192-30821214 AAGCCTGGACAGCTTCCACGTGG + Intergenic
1054773333 9:69103500-69103522 AAGCTGGGACAGTTTACAATGGG + Intergenic
1056094249 9:83234737-83234759 AAGATTGGAAAGCTTGGAGTAGG - Intergenic
1060155097 9:121313995-121314017 GAGCTTGGCCAGCTTGCGGTTGG - Exonic
1060279067 9:122203884-122203906 ATGTTTGGACAGGTTAGAGTTGG - Exonic
1186847355 X:13543961-13543983 AAGCTTGCAGATCTTACTGTTGG - Intergenic
1187013048 X:15299340-15299362 AAGGTTGGACAACTCAAAGTGGG + Intronic
1188267882 X:28100318-28100340 AGGCTTGGGAAGCTTTCAGTAGG + Intergenic
1188509520 X:30920369-30920391 AAGCTTGCTCAGCTTCCTGTAGG + Intronic
1188731178 X:33648055-33648077 AAGCTTTGGCAGCTTACATGTGG - Intergenic
1193345883 X:80403989-80404011 AAGGTGGGACAACTTAAAGTAGG + Intronic
1193799634 X:85919221-85919243 AACCTTATACAGCTTCCAGTGGG - Intronic
1197375265 X:125675274-125675296 AAGCCTTGACAGCTTACACATGG - Intergenic
1197441284 X:126494335-126494357 AAGCCTTGACAGCTTACACATGG + Intergenic
1197568728 X:128121512-128121534 AAGGTGGGACAGCTTGAAGTGGG + Intergenic
1198629270 X:138616822-138616844 AAGCTTTGGCAGCTTACACATGG - Intergenic
1199041458 X:143119654-143119676 AAGCATTGACAGCTTACATATGG - Intergenic
1199147056 X:144380755-144380777 AAGCTTTGGCAGCTTACACTTGG + Intergenic