ID: 1100245695

View in Genome Browser
Species Human (GRCh38)
Location 12:92754354-92754376
Sequence GAGCCATGACCTCAAATCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100245695_1100245698 -10 Left 1100245695 12:92754354-92754376 CCACTGATTTGAGGTCATGGCTC 0: 1
1: 0
2: 3
3: 14
4: 118
Right 1100245698 12:92754367-92754389 GTCATGGCTCTTGGAAATGTGGG 0: 1
1: 0
2: 1
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100245695 Original CRISPR GAGCCATGACCTCAAATCAG TGG (reversed) Intronic
903556235 1:24195733-24195755 GAGCCAAGATCTGAAATCACAGG - Intergenic
906948445 1:50315493-50315515 GAACCAGGACCTCAATACAGGGG - Intergenic
910209810 1:84781547-84781569 GAGCCATGATCTGAACTCAAAGG - Intergenic
911026493 1:93441148-93441170 CAGCAATGCCCTCAAATCTGTGG + Intergenic
911578866 1:99612096-99612118 GTTCCAGGACCTGAAATCAGAGG + Intergenic
911699873 1:100940152-100940174 AAGACAGCACCTCAAATCAGTGG + Intronic
912481112 1:109982965-109982987 CAGCCCTGAACACAAATCAGTGG + Intergenic
914732412 1:150383284-150383306 GAGACCTGGCCTCAAATAAGAGG + Intronic
916821975 1:168408644-168408666 GAGGGATGACCTCAAATATGAGG + Intergenic
917509114 1:175655702-175655724 CAGCCATGACCTTATATAAGTGG + Intronic
918641807 1:186850091-186850113 GAGTCATGAAATCAATTCAGTGG + Intronic
919759424 1:201087952-201087974 GAACCAAGCCCTCAACTCAGAGG - Intronic
920057509 1:203203116-203203138 GAGCCATGACCTCAGATTGAGGG - Intergenic
920076626 1:203342033-203342055 GTTCCATGACCTCAGATCATTGG + Exonic
921009300 1:211125085-211125107 GAGACATAACCTTTAATCAGGGG + Intronic
922059093 1:222070304-222070326 CAGCCATCATCTCAAATGAGCGG - Intergenic
922122891 1:222691138-222691160 GAGCCATGACCTAGGATGAGAGG + Intronic
922177090 1:223205128-223205150 GAGCCCTCACCAGAAATCAGTGG - Intergenic
922900733 1:229134698-229134720 GAGGCAGCACCTCAAATCACAGG + Intergenic
923157617 1:231292428-231292450 GAGACATAACATCAACTCAGGGG - Intergenic
923845927 1:237732575-237732597 GAGCCATCACCTCAACTTGGAGG + Intronic
924193775 1:241583429-241583451 GAGCTAAGACCTGGAATCAGGGG + Intronic
1063530020 10:6821774-6821796 GAGACATAACCTAAAATGAGAGG - Intergenic
1064448519 10:15419796-15419818 AAGCAATGAGCTCAAATGAGTGG + Intergenic
1066539317 10:36428259-36428281 GAGCCATGACATCAATGCATAGG + Intergenic
1067758273 10:49023524-49023546 GAGCCAGGAGCTGAAAGCAGTGG + Intronic
1069060851 10:63892988-63893010 CAGCCACGTCATCAAATCAGTGG + Intergenic
1070344719 10:75530681-75530703 GAGCCATTACCTGAAACCAAGGG - Intronic
1071668692 10:87586852-87586874 GAGACCTGAGATCAAATCAGTGG - Intergenic
1073348251 10:102800682-102800704 AAGCCATGACCTCAATAAAGAGG - Intronic
1073529090 10:104215291-104215313 GAGCTATGCCCTCAAATGAGGGG + Intronic
1078114737 11:8435078-8435100 AAGCCATGATCTCCAAACAGTGG - Intronic
1081129897 11:39366016-39366038 GAGGAATGAGCTCAAAGCAGAGG + Intergenic
1085686843 11:78631225-78631247 GAGCAATGGCCTGAAATCAGGGG + Intergenic
1087949809 11:104207084-104207106 GAGTCAGGCCCTGAAATCAGGGG + Intergenic
1090802234 11:130180109-130180131 GAGCCTTGGCCACAAATCAGTGG + Intronic
1090986250 11:131768834-131768856 AAGCCATGACTTCTAATCCGTGG + Intronic
1093809086 12:23470958-23470980 AAGCCATGCCCTCAAAACAGGGG - Intergenic
1094307916 12:29041613-29041635 TTGCCATGACCACAAATCAGAGG + Intergenic
1094553360 12:31473220-31473242 GAGCCATTGCCTCAACACAGTGG + Intronic
1100245695 12:92754354-92754376 GAGCCATGACCTCAAATCAGTGG - Intronic
1102624635 12:114225188-114225210 GACCCCTGACCCCAGATCAGTGG - Intergenic
1102904776 12:116666134-116666156 GAGCCATGAGCACAGGTCAGGGG + Intergenic
1103307869 12:119980525-119980547 GAGCAATTGCCTCAAAGCAGAGG + Intergenic
1109810507 13:67507805-67507827 GAGCCATGACCCCAAATACATGG - Intergenic
1112430353 13:99345582-99345604 GAGCCATGAGCTCAATAAAGTGG - Intronic
1114908026 14:27154354-27154376 GAGGCATGTCCTAAAATCATAGG - Intergenic
1119747419 14:77054069-77054091 GAGCCCTAACCTCTAATGAGAGG + Intergenic
1123174238 14:106401719-106401741 GAGCCTTGACCTCAAAGCAGCGG - Intergenic
1123182450 14:106482654-106482676 GAGCCTTGACCTCAAAGCAGCGG - Intergenic
1202944452 14_KI270726v1_random:14075-14097 GAGCCTTGACCTCAAAGCAGCGG + Intergenic
1125078106 15:35644053-35644075 GAGCCATGACATCAAGTTAGTGG - Intergenic
1126408060 15:48343265-48343287 GAGCCATGAAATCAACTCAGTGG + Exonic
1126899291 15:53295750-53295772 GACACATGTCCTCAAATCAATGG + Intergenic
1127649202 15:60990040-60990062 GATCCATGAGTTCAAATTAGTGG - Intronic
1127872331 15:63083763-63083785 GAGAGATGACCTCAAATAGGAGG - Intergenic
1134475687 16:14571513-14571535 GAGCCTTGACCAGAAAGCAGAGG - Intronic
1134480054 16:14611505-14611527 GAGACAAGAGCTCAGATCAGAGG + Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1139657239 16:68396380-68396402 GGGCCATCACATCAAATCAGTGG - Intronic
1141040585 16:80669543-80669565 GAGCCATGAAAGCCAATCAGAGG + Intronic
1141468203 16:84221022-84221044 GAGCAATGACTTCCAAGCAGTGG - Exonic
1142365189 16:89646388-89646410 GAGCCCTGATCTCGACTCAGAGG - Intronic
1142986621 17:3698876-3698898 GAGGCATGACATCAAATTACTGG + Intergenic
1144808859 17:17985703-17985725 GAGCAAGCACCTCAAATCAGGGG + Intronic
1145762276 17:27432165-27432187 GAGACATGACCTAAAGGCAGAGG - Intergenic
1146312576 17:31780467-31780489 AAGCCATGACCTTAACCCAGGGG - Intergenic
1147177692 17:38666585-38666607 GTGTCATCACCTAAAATCAGGGG - Intergenic
1148085128 17:44989423-44989445 GAACTTTGAACTCAAATCAGCGG + Intergenic
1151552983 17:74832470-74832492 GAGCCACGCCCCCAAAACAGGGG - Intronic
1154030164 18:10746513-10746535 GAGCCATGAGGTCACATCAAGGG - Intronic
1158661089 18:59388118-59388140 GATCGATGAGCTCAAATCACAGG + Intergenic
1159272291 18:66168491-66168513 GAGCAATGGCCTGGAATCAGAGG - Intergenic
1159340230 18:67125025-67125047 GAGCCATGACCTAACAACAGAGG - Intergenic
1162142903 19:8595506-8595528 CAGCCCAGCCCTCAAATCAGGGG + Intronic
1168638151 19:58012454-58012476 AAGCCCAGAGCTCAAATCAGGGG + Intergenic
926434614 2:12825182-12825204 AAACTATGACCACAAATCAGAGG - Intergenic
929450870 2:42036184-42036206 GAGCCAGGCCCTCAGAACAGTGG + Intergenic
935975505 2:108574484-108574506 GAGCCATGACCTCGAGTGAAAGG - Intronic
937201756 2:120208630-120208652 GAGCCCTGACCTCAACCTAGGGG + Intergenic
1170825141 20:19787459-19787481 GAGAAATGACCTCAAATGCGGGG + Intergenic
1173286020 20:41672099-41672121 GAGCATTCACATCAAATCAGGGG + Intergenic
1178344155 21:31810772-31810794 GAGCCAGGACTGCAGATCAGAGG - Intergenic
1179031055 21:37719802-37719824 GAGCCTTGTCCTCGAATCAGTGG + Intronic
1179588429 21:42388914-42388936 GAGCCATGACCTTACCACAGCGG + Exonic
1183522648 22:38304254-38304276 AAGGCAGGACCTCACATCAGAGG + Intronic
949501841 3:4687535-4687557 CAGCCATCACCTCATTTCAGAGG - Intronic
949565358 3:5239805-5239827 GAGCCAGGGCCACAAATCAGAGG + Intergenic
951435621 3:22660164-22660186 GAGCCATGATCCCAAATATGTGG - Intergenic
951847818 3:27103547-27103569 GAGCCATGATCCCACATGAGGGG + Intergenic
953911583 3:46895936-46895958 GAAGCATGAGCTCACATCAGAGG - Intronic
963330497 3:143909982-143910004 GAGCTAGGACCTGGAATCAGGGG - Intergenic
963724637 3:148906248-148906270 GATTTGTGACCTCAAATCAGGGG - Intergenic
965595460 3:170406403-170406425 GAACTCTGACCTCAAATCATCGG + Intergenic
967225243 3:187284789-187284811 GAGCCATGACCCCATTTCACAGG - Intronic
969837727 4:9857220-9857242 GTGCGATGGCCTCAAATCACAGG - Intronic
972271063 4:37511147-37511169 GAGCCAAGGCCTGGAATCAGGGG + Intronic
975590320 4:75993376-75993398 GAACCTTGACCTCAAATAATAGG - Intergenic
976728482 4:88239826-88239848 GAGCCAAGGCCTCTAATTAGGGG + Intergenic
983513901 4:168637084-168637106 GTGCGATGACTACAAATCAGTGG + Intronic
984063296 4:175018833-175018855 GAGCACTGAACTCACATCAGTGG + Intergenic
985720891 5:1488117-1488139 CAGCCTGGACCTCAAAACAGAGG + Intronic
986432711 5:7697367-7697389 GAGCCATGAACTCATATCGAAGG - Intronic
990803145 5:59628562-59628584 GAGCCCTAACCTCAAGCCAGAGG + Intronic
1010475813 6:76286177-76286199 GAGCAAAGGCCTGAAATCAGAGG + Intergenic
1010555265 6:77271740-77271762 GTGCCATGGACTGAAATCAGAGG - Intergenic
1019571370 7:1714039-1714061 GAGGCATGACTTCAAATGCGGGG - Intronic
1025929530 7:65982663-65982685 GAGCCCTGACCTTAACCCAGGGG + Intergenic
1026464675 7:70643932-70643954 GAGCCAGGACGTCATAGCAGAGG - Intronic
1028033525 7:85949762-85949784 GACCTATGGCCTGAAATCAGGGG + Intergenic
1028972610 7:96875662-96875684 GAGCCAAAGCCTGAAATCAGGGG - Intergenic
1029889882 7:103916539-103916561 GAGACCTGTCCTTAAATCAGAGG - Intronic
1029934255 7:104406781-104406803 AAGCAATGGCCTCAAACCAGTGG + Intronic
1033717904 7:144021781-144021803 CAGCCATGGCCTTCAATCAGCGG + Intergenic
1035456371 7:159011602-159011624 GAGCCAGGACCACAGAGCAGGGG + Intergenic
1038545059 8:28419670-28419692 GTGCCCTGAACTCAAATAAGAGG + Intronic
1042689962 8:71486660-71486682 GAGCCAAGACCTGACAGCAGGGG + Intronic
1045765097 8:105658162-105658184 GAGTTATGGCATCAAATCAGGGG + Intronic
1046104683 8:109651236-109651258 GAGAAATGACCTTAACTCAGAGG + Intronic
1046317926 8:112531212-112531234 GAGCAGTGGCCTGAAATCAGGGG - Intronic
1046684501 8:117209964-117209986 GAGCCTTGTCCTCCAATGAGGGG + Intergenic
1047427440 8:124759584-124759606 GAGCCATGCCTTAGAATCAGAGG - Intergenic
1047672102 8:127159201-127159223 GAGCCGTGACCTAAATTTAGCGG + Intergenic
1047907138 8:129484225-129484247 GATCCATCATCTCAACTCAGTGG - Intergenic
1048871974 8:138806701-138806723 GAGCCCTGAGCTCACAGCAGCGG + Intronic
1056893276 9:90516190-90516212 GAGCCTTTACCTTAAATAAGGGG + Intergenic
1056956761 9:91088765-91088787 GAGCCAAGACAGCAAGTCAGTGG - Intergenic
1057825553 9:98369907-98369929 CCTCCATGACCTCAAATCAAGGG + Intronic
1057867715 9:98694228-98694250 GGGCCTAGACCTCAAATCATGGG - Intronic
1061750971 9:132776793-132776815 TAGCCATGACTTCAAAGCTGGGG - Intronic
1186162499 X:6792491-6792513 GAGTCATGACCTCTTTTCAGAGG - Intergenic
1188568999 X:31559717-31559739 GAGCCCTAACCTCAAGTAAGAGG - Intronic
1189628194 X:42921607-42921629 GAGCCAAGGCCTGGAATCAGGGG - Intergenic
1193953931 X:87835360-87835382 GAGCCAGGACCCTAAATCACAGG + Intergenic
1199298281 X:146183844-146183866 CAGCCAGGACCTAAAATCAGGGG + Intergenic
1201922870 Y:19253619-19253641 GAGTCAAGACCTCAAATCTTTGG + Intergenic