ID: 1100245851

View in Genome Browser
Species Human (GRCh38)
Location 12:92756191-92756213
Sequence TCTAGAAAGTTCATGACATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100245851 Original CRISPR TCTAGAAAGTTCATGACATT TGG (reversed) Intronic
906090624 1:43176410-43176432 AATATAAAGGTCATGACATTGGG + Intronic
906354831 1:45095568-45095590 TCTAGAGACTTGATGAGATTTGG + Intronic
907766750 1:57420606-57420628 TCAAGAAAGTGGATGGCATTTGG - Intronic
908822363 1:68101708-68101730 TCTAGAAACTTCATGAATTGGGG + Intronic
908965452 1:69756752-69756774 TCTAGAAAGAAAATGACATGGGG + Intronic
909096869 1:71298222-71298244 TCTTGAAGGTACATTACATTAGG - Intergenic
910499903 1:87878361-87878383 TTTAAAAAATTCGTGACATTGGG - Intergenic
910696091 1:90017380-90017402 TCTGGAAAGTTCTTCACATCAGG + Exonic
911544059 1:99194936-99194958 TCAAGTAATTTAATGACATTGGG - Intergenic
913192941 1:116428972-116428994 CCTACAAAGTGCACGACATTGGG + Intergenic
913469793 1:119176492-119176514 GCTAGAAAGTTCAAGAGATCTGG - Intergenic
914980794 1:152412828-152412850 TCTAGAAAGCCCATTGCATTTGG - Intronic
918374439 1:183894975-183894997 TCTGGAAATTTCAAGACATCAGG + Intronic
922220548 1:223554973-223554995 TCTAGAAATTTCGTGTCATCTGG - Intronic
924734696 1:246745532-246745554 TCCAGAAAGTTCATGATCTCTGG - Intronic
1063560849 10:7125616-7125638 TCTAGAATGCTCCTGACATAGGG + Intergenic
1065228995 10:23577681-23577703 AATAGGAAGTTAATGACATTTGG + Intergenic
1065234104 10:23629732-23629754 GATAGAAAGTTCATGCCATGTGG + Intergenic
1065454115 10:25888905-25888927 ACTTGAAGGTTTATGACATTTGG + Intergenic
1066507337 10:36058864-36058886 TCTGAAAAGTGCAGGACATTGGG + Intergenic
1067204723 10:44202922-44202944 TCTAGAAAGTTTAAGGCTTTTGG + Intergenic
1068747199 10:60546796-60546818 TCAAGAAAGTTTATAACATCAGG + Intronic
1072206537 10:93210038-93210060 TCCAGAAAGAACATGACTTTTGG - Intergenic
1073601088 10:104846812-104846834 TGTAGAGAGTTCATGAGGTTGGG + Intronic
1078137106 11:8660630-8660652 TGCAGAAAGTTTATGACATCTGG + Intronic
1079285014 11:19121068-19121090 TCAAAAAGGTCCATGACATTTGG + Intronic
1079643983 11:22840832-22840854 TCTGGAAAGTTGCTAACATTTGG + Intergenic
1080598921 11:33802996-33803018 TCCAGCAAATTCAGGACATTTGG - Intergenic
1083493931 11:63034012-63034034 TCTAGACAGTTCCTTAAATTGGG + Intergenic
1085458600 11:76679661-76679683 TTTAAAAAGTTCATGAAGTTTGG + Intergenic
1085560190 11:77465453-77465475 TCTAGAAAGTCCAGGAAACTTGG + Intronic
1085918206 11:80917919-80917941 TCTAGAAAGTAGAAGAAATTTGG - Intergenic
1086546821 11:88006403-88006425 TCCAGAAATCTCATTACATTTGG + Intergenic
1088396228 11:109372731-109372753 TCTAAAGAGTTGATGACATTTGG + Intergenic
1090046190 11:123335924-123335946 GCTATAAAGTTAATGACATAGGG - Intergenic
1094081476 12:26540520-26540542 TCTAGTAAGTATAGGACATTTGG - Intronic
1094198466 12:27774268-27774290 TTTAGTAAATTCAAGACATTTGG + Intergenic
1094209889 12:27877992-27878014 TCTTGAAAGGTGGTGACATTGGG + Intergenic
1095395963 12:41762688-41762710 TCTCCATAGTCCATGACATTGGG - Intergenic
1095479862 12:42623626-42623648 TCAAGAAATTTCATGACCCTTGG + Intergenic
1095825196 12:46523740-46523762 CTTAGAAAGTGCATGACCTTGGG + Intergenic
1096463137 12:51833835-51833857 ACTAGAAAGTTCATGAGAGCAGG + Intergenic
1097348425 12:58520739-58520761 CCTAGAAAGTTCATGTGATTTGG + Intergenic
1097507120 12:60487812-60487834 ACTAGAAAATTCATGAAATGAGG - Intergenic
1097510781 12:60536860-60536882 TCTAGAAAGTTCATAGAATCTGG + Intergenic
1099939531 12:89169156-89169178 TTTTGAAAGTTCATGATTTTGGG - Intergenic
1100245851 12:92756191-92756213 TCTAGAAAGTTCATGACATTTGG - Intronic
1100755070 12:97742400-97742422 TATGGAAAGCTCATGGCATTTGG - Intergenic
1101367446 12:104087537-104087559 TTAAGAAATTTTATGACATTAGG + Intronic
1102527314 12:113521079-113521101 TCTAGAAAGTTCTTTGCTTTGGG + Intergenic
1103064943 12:117889693-117889715 TAAAGCAAGTTCCTGACATTTGG - Intronic
1104127257 12:125860115-125860137 GCTAGAAATATCTTGACATTGGG + Intergenic
1107665020 13:42679656-42679678 TTAAGAAAGTTCAGGAGATTGGG + Intergenic
1108524994 13:51279060-51279082 TCAAGAAAGAAAATGACATTAGG + Intronic
1108748701 13:53423698-53423720 TCTAGAAAATACATGACATATGG + Intergenic
1108801358 13:54099932-54099954 TGTAGGAAATTCAAGACATTTGG - Intergenic
1108838552 13:54582531-54582553 ACTAGAAAATTCAGTACATTTGG - Intergenic
1109491465 13:63105861-63105883 TATAAATAGTTCATGACACTGGG + Intergenic
1110169432 13:72483447-72483469 TATAGAAAGGTCCTGACTTTGGG - Intergenic
1110877627 13:80529135-80529157 TGTAAAAAGTTTATGAAATTGGG + Intergenic
1111119969 13:83833943-83833965 TCTGGCAAGTTCTTGAAATTTGG + Intergenic
1111123728 13:83885405-83885427 TCTAGAAACTTGATGCCATTTGG - Intergenic
1111750242 13:92320772-92320794 TCGTGTAAGTTCAAGACATTTGG - Intronic
1114864738 14:26575205-26575227 TTTATAAAGTTCATCACATTGGG - Intronic
1115289961 14:31759122-31759144 TCTAGAAAATTCTTCAAATTTGG + Intronic
1118381639 14:65222479-65222501 TCTAGAAAATTCCTGGCATCTGG - Intergenic
1118619183 14:67599450-67599472 TTTAGAAAGTACTTGAAATTGGG + Intronic
1119888326 14:78163310-78163332 CTTAGAAAATTCATAACATTAGG - Intergenic
1124122257 15:26897913-26897935 TCTTCCAAGTTCATGACACTTGG + Intronic
1127678510 15:61269596-61269618 CCTAGAAAGCTAATGACTTTGGG - Intergenic
1127951437 15:63811004-63811026 TCAATAAAGTTAATGTCATTTGG + Intronic
1129925069 15:79356521-79356543 TCTGGAAATTTCATGACAGCAGG - Intronic
1130689140 15:86065303-86065325 TCTAGTAAGTTCATGACAATTGG - Intergenic
1132102188 15:99032075-99032097 TCAATAGAGTTTATGACATTAGG + Intergenic
1134779723 16:16884846-16884868 TCTAGAAAGTTCTTGTCCATTGG - Intergenic
1138940054 16:61779107-61779129 TGTAGAAAGTACATGACTATTGG - Intronic
1139768923 16:69256538-69256560 TCTAGATACTTCATGAAAGTAGG + Intronic
1143776260 17:9201101-9201123 TCTAGAAAGTTCATCTTATGAGG + Intronic
1151256024 17:72877310-72877332 TCAAGAACATTCATGACACTGGG + Intronic
1153819774 18:8823520-8823542 GCTGGAAAGCTCATGACCTTGGG + Intronic
1154985869 18:21550262-21550284 TCTAAAAAGTTGATGACTGTTGG - Intronic
1156682389 18:39606710-39606732 TCTTGAAAGTTCAAAACATGTGG + Intergenic
1157269045 18:46256017-46256039 TCTAGAAAGATCCTGACATGGGG - Intronic
1158231378 18:55259493-55259515 TCTTTAAAGTACATGCCATTGGG - Intronic
1158363553 18:56705254-56705276 TCTAGAAAGTGCCTGAAATATGG - Intronic
1164371916 19:27650775-27650797 TAGAGAAACTTCACGACATTAGG - Intergenic
1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG + Intergenic
925558330 2:5157366-5157388 TTTAGAATTTTCATGAAATTTGG - Intergenic
926523414 2:13946153-13946175 TCTAGAAGTTTCATAAAATTTGG + Intergenic
927757653 2:25722187-25722209 TATATAAAATTCATGATATTAGG + Intergenic
928112851 2:28524677-28524699 TGGAGAAAGTTAATGACTTTAGG + Intronic
933989029 2:87620226-87620248 TCTAGGATGATCATGACCTTTGG - Intergenic
935365159 2:102281452-102281474 TTTACTAACTTCATGACATTGGG + Intergenic
936110641 2:109661671-109661693 CCTAGAAAGTGCAAGACATGGGG + Intergenic
936304814 2:111330600-111330622 TCTAGGATGATCATGACCTTTGG + Intergenic
936894789 2:117414888-117414910 TCTAGAAATTTTATGACTTTAGG + Intergenic
937585319 2:123540450-123540472 TCTAGAATTTTTATAACATTAGG + Intergenic
939627916 2:144501214-144501236 TGGAGAAAGTTCCTGAGATTGGG - Intronic
940455884 2:153899604-153899626 TCTAGTATGTTAAAGACATTGGG - Intronic
941560976 2:167043872-167043894 TCTACAATGATGATGACATTTGG - Intronic
941768008 2:169319259-169319281 ACTGGAAAATTCATGAGATTTGG + Intronic
941938589 2:171008765-171008787 TATAGAAAGTTCAAGTCACTGGG + Intronic
944580667 2:201129968-201129990 TCCAGAAGGTCCCTGACATTAGG - Exonic
947018759 2:225650757-225650779 TCCAGAAAGTACAGGATATTTGG - Intronic
948952965 2:241266707-241266729 TCTAGAAAGGGCATGGGATTTGG + Intronic
1168777888 20:462931-462953 TCTAGCAGGTTCATGTCATACGG + Intergenic
1168861541 20:1049263-1049285 TCTGGAAATTTCAGGACAGTGGG - Intergenic
1169088651 20:2843042-2843064 TCTAGGAAGTATATCACATTAGG - Intronic
1170319260 20:15077328-15077350 TGTTTCAAGTTCATGACATTAGG + Intronic
1172687131 20:36764416-36764438 TCTAGAAAATACATGAACTTGGG - Intronic
1178761065 21:35403429-35403451 TCTGGACAGTTCATGACACTGGG + Intronic
1181781496 22:25196868-25196890 TCTGGGAAGTGCATGACTTTAGG - Exonic
1183220381 22:36508264-36508286 TGAAGAAAGTAAATGACATTCGG - Intergenic
1185280951 22:49969655-49969677 TCTAGAAAGGACATGAGATATGG + Intergenic
1185292541 22:50034519-50034541 TCCAGAAAGTGCATGAGACTTGG + Intronic
949603250 3:5624841-5624863 TTTATAAATTTCATCACATTGGG - Intergenic
952225589 3:31372279-31372301 TCTAGAGGGTTCCTGAAATTAGG - Intergenic
953023628 3:39131916-39131938 CCAGGAAAGCTCATGACATTTGG + Intronic
953680176 3:45033270-45033292 TGAAAAAAGTTCATGACATATGG + Intronic
957796040 3:85009071-85009093 TCTAAAATGTTCCTGACATCTGG - Intronic
959929928 3:111969082-111969104 CCTGGACAGTTCATTACATTAGG + Intronic
960746358 3:120894161-120894183 TCCAGAAAATTCAAGATATTTGG + Intergenic
960870989 3:122249589-122249611 TTTAGAAGGTTCTTGACATCAGG - Intronic
963287867 3:143453886-143453908 TTTGGAAAGTGAATGACATTGGG + Intronic
963322280 3:143822031-143822053 TCTGGAAAGTGCATGACGTTGGG - Intronic
963462568 3:145635977-145635999 TTTTGAAAGTTTATGACAATTGG - Intergenic
963594762 3:147312034-147312056 TCTTGACAGTTCATGTCAATGGG - Intergenic
963776036 3:149441720-149441742 CCTACTAAGTGCATGACATTTGG - Intergenic
965910959 3:173774764-173774786 TCTTGAAATTTCAAGATATTTGG + Intronic
967193690 3:187007788-187007810 ATTAGAAAGTTCTTGAAATTAGG + Intronic
970348941 4:15181544-15181566 TCCAGAAAGAACATGACCTTGGG + Intergenic
970499028 4:16658084-16658106 TATAAAAAGTTAATGATATTAGG + Intronic
971861983 4:32119667-32119689 TATAGAAAGATCATGCCACTGGG - Intergenic
974146242 4:57951392-57951414 TCTAGGAAGTTTTTAACATTTGG + Intergenic
976465952 4:85368900-85368922 TCAAGAATTTTCCTGACATTAGG + Intergenic
976616647 4:87084751-87084773 TCTACAAACTGCAAGACATTTGG + Intronic
976749734 4:88442073-88442095 TGTATAAAAATCATGACATTTGG - Intronic
977740874 4:100480211-100480233 TCTTGAAAATTCATGCCACTGGG - Intronic
978961556 4:114685705-114685727 TCTAAAAAATATATGACATTTGG - Intergenic
979589128 4:122458212-122458234 TATAAAAAGTTCATGAGATTTGG - Intergenic
980039484 4:127923004-127923026 TCTAGAAGCTTGATGAAATTTGG - Intronic
980702153 4:136445775-136445797 ACCAGAAAGTACATGAAATTAGG + Intergenic
981908139 4:149946822-149946844 TCTAGAAAATTAATAAAATTGGG + Intergenic
983009789 4:162532977-162532999 TTTTGAAAGTTAATGACAATTGG - Intergenic
983832943 4:172352923-172352945 TCTTGAAAGTTGTTGGCATTGGG - Intronic
984619693 4:181938246-181938268 TGTAGAAAGTTAAAGTCATTTGG + Intergenic
990204137 5:53410636-53410658 TGTAAAAAGATCATGATATTTGG - Intergenic
990824696 5:59885605-59885627 TCTACAAGATTCATTACATTTGG - Intronic
992683447 5:79176235-79176257 TCTACAAAGTTCTTGACAAGTGG + Intronic
993088319 5:83392559-83392581 TTGAGAAATTTCATGAGATTAGG + Intergenic
994084338 5:95742161-95742183 TCTAGGATGCTCATGACTTTAGG + Intronic
994320501 5:98388987-98389009 TTTACTAAGTCCATGACATTGGG - Intergenic
994705565 5:103201325-103201347 TATAGAAAGGTAATGACAATGGG - Intronic
994986086 5:106935345-106935367 TCTAGAGAGTCCAAGACACTTGG - Intergenic
996294909 5:121901169-121901191 TCAAGTAAGTTAATGTCATTGGG - Intergenic
996804887 5:127443400-127443422 AGTAGAAAGTTCATGAGTTTTGG - Intronic
997856899 5:137380821-137380843 TCAAGAAAGGACATGAGATTTGG - Intronic
998557567 5:143140484-143140506 TATATAAAGTACTTGACATTGGG + Intronic
998903922 5:146883158-146883180 TTTATAAATTTCATGACCTTTGG + Intronic
1000003073 5:157158480-157158502 TCTGGAAAGAGCATCACATTGGG + Intronic
1000820780 5:165980792-165980814 TCTAGAAAGTCCAGGTCATGTGG + Intergenic
1000976742 5:167773469-167773491 TCTATGAAGTTGATGTCATTTGG - Intronic
1004082605 6:12409485-12409507 TCTAGAATGTTCTTGAAAATGGG - Intergenic
1005290678 6:24375701-24375723 TCTACAATGTTCAAGACAGTAGG + Intergenic
1005610167 6:27516229-27516251 TCTACTAACTTCTTGACATTGGG + Intergenic
1007226485 6:40318962-40318984 TCTAGAGAAATCAGGACATTAGG - Intergenic
1008233840 6:49019236-49019258 TCTGGGCAGTTCATGGCATTTGG + Intergenic
1012681541 6:102188591-102188613 AATAGAAATTTCATGACATCAGG + Intergenic
1015453446 6:133397420-133397442 TCTAGCAAATTCTTGATATTAGG + Intronic
1015964716 6:138686748-138686770 TCTAGAAAGCTCATTGGATTAGG - Intronic
1016150746 6:140738873-140738895 TCTAGAAATTTCATGGTTTTGGG + Intergenic
1017423555 6:154297338-154297360 CCTAGAAAGGTAATGACTTTGGG - Intronic
1018095210 6:160380863-160380885 TCTAGAAAATTCAAGATATGTGG + Intronic
1019769100 7:2872102-2872124 TCAGGAAAGTTCATAACATGCGG - Intergenic
1023457403 7:40355272-40355294 TCTGACAAGTTTATGACATTAGG - Intronic
1025744128 7:64227973-64227995 ACAGGCAAGTTCATGACATTTGG - Intronic
1027334980 7:77140621-77140643 TCTGGAAATATCATCACATTGGG + Intronic
1027623001 7:80515493-80515515 TCCAGAGAGTTCATGCCTTTTGG + Intronic
1027691204 7:81347385-81347407 GCTAGGAAGTACATGATATTTGG - Intergenic
1028006418 7:85574818-85574840 TCTTGAATGTTCACGAGATTTGG + Intergenic
1029780818 7:102730492-102730514 TCTGGAAATATCATCACATTGGG - Intergenic
1030988553 7:116271717-116271739 TCCACAAAGTTCAAGACATTTGG + Intergenic
1032821421 7:135527622-135527644 TCTTCAGAATTCATGACATTTGG - Intergenic
1038923287 8:32109919-32109941 ACTAGAAAGTTAAAGAGATTTGG - Intronic
1039278903 8:35960324-35960346 TGTGGAAAATTGATGACATTTGG + Intergenic
1039348466 8:36734250-36734272 GATATAAAGTGCATGACATTTGG + Intergenic
1039775712 8:40734217-40734239 TCTCCAAATTTCAGGACATTTGG + Intronic
1040947673 8:52901179-52901201 CCCAGAAAGGTCATAACATTGGG - Intergenic
1040989294 8:53332260-53332282 TCTAGAAATTTCATGTAAATGGG + Intergenic
1040996144 8:53405021-53405043 TCTGGAAATTTCATAATATTGGG + Intergenic
1041061322 8:54037564-54037586 TATATACAGTGCATGACATTTGG + Intergenic
1041835361 8:62206664-62206686 TATAGAAAACTAATGACATTGGG - Intergenic
1044230982 8:89777265-89777287 CCTCTAAAGTTCATGCCATTAGG - Intronic
1044261137 8:90123397-90123419 TAAATAAAGTTCATGACATACGG - Intergenic
1044374031 8:91448317-91448339 ACTAGAATATGCATGACATTTGG - Intergenic
1046027115 8:108738427-108738449 TACAGAAAGTTCATTTCATTTGG + Intronic
1046827146 8:118703709-118703731 CCTAGAAATTCCATTACATTTGG + Intergenic
1047413048 8:124639909-124639931 TATAAACAGTTTATGACATTTGG + Intronic
1050704576 9:8382634-8382656 TCTAGAAAGTTCTACACTTTTGG - Intronic
1051505588 9:17824304-17824326 TAGAGAAACTTCATGACCTTAGG + Intergenic
1053424258 9:38000699-38000721 CCTATAAAGTGCATGGCATTTGG + Intronic
1055884177 9:81039725-81039747 TCTCCAAAGTTCTTGACACTAGG - Intergenic
1056875873 9:90329928-90329950 TCTGGAAAGTTGATGGGATTGGG - Intergenic
1060361234 9:122959579-122959601 TCAAGAAAATTCATAAAATTTGG + Intronic
1060904428 9:127292136-127292158 ACTTGAAAGCCCATGACATTTGG + Intronic
1062349426 9:136131836-136131858 TCTGGAAAGATCATTCCATTAGG + Intergenic
1185489671 X:511672-511694 TCTCCAAAGTTGATGATATTGGG + Intergenic
1186616577 X:11194787-11194809 TCTTGAACAGTCATGACATTTGG - Intronic
1187459448 X:19473207-19473229 TCCAGAAAGTTTAAGAAATTTGG + Intronic
1188207981 X:27382528-27382550 TATGGAAAGTTCATTACTTTAGG - Intergenic
1189519766 X:41753925-41753947 TCTAGAAAATTCCTAACATTTGG + Intronic
1190497771 X:51042862-51042884 CCTGGAAAGTTTATGACATCTGG + Intergenic
1192772818 X:74210621-74210643 TATATAATCTTCATGACATTGGG + Intergenic
1193527666 X:82612896-82612918 CGTAAAAAGTTCATGAGATTTGG + Intergenic
1194585900 X:95734021-95734043 GGTAGAAAGTTCAAGACATGGGG - Intergenic
1195457460 X:105084747-105084769 TATAAAAAGTACATGACATTTGG + Intronic
1196246394 X:113404668-113404690 TGTATAAAGGACATGACATTTGG + Intergenic
1196960848 X:120999874-120999896 TCAAGAAAGTTCATTGCAATTGG + Intergenic
1198302809 X:135348035-135348057 TCTGACAACTTCATGACATTCGG - Intronic
1200040799 X:153366215-153366237 TCTGGAAGGTTCCTGACAGTGGG + Intergenic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic