ID: 1100248112

View in Genome Browser
Species Human (GRCh38)
Location 12:92784863-92784885
Sequence CCATCTACTCCCCTTGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 453}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100248109_1100248112 5 Left 1100248109 12:92784835-92784857 CCATGGTTTTGTTGGGACTATCT 0: 1
1: 0
2: 1
3: 12
4: 127
Right 1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG 0: 1
1: 0
2: 1
3: 54
4: 453
1100248104_1100248112 18 Left 1100248104 12:92784822-92784844 CCTCTCTCCCATTCCATGGTTTT 0: 1
1: 0
2: 4
3: 43
4: 385
Right 1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG 0: 1
1: 0
2: 1
3: 54
4: 453
1100248107_1100248112 11 Left 1100248107 12:92784829-92784851 CCCATTCCATGGTTTTGTTGGGA 0: 1
1: 0
2: 0
3: 24
4: 261
Right 1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG 0: 1
1: 0
2: 1
3: 54
4: 453
1100248100_1100248112 30 Left 1100248100 12:92784810-92784832 CCCTCGGAGAACCCTCTCTCCCA 0: 1
1: 0
2: 2
3: 10
4: 137
Right 1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG 0: 1
1: 0
2: 1
3: 54
4: 453
1100248108_1100248112 10 Left 1100248108 12:92784830-92784852 CCATTCCATGGTTTTGTTGGGAC 0: 1
1: 0
2: 2
3: 9
4: 129
Right 1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG 0: 1
1: 0
2: 1
3: 54
4: 453
1100248101_1100248112 29 Left 1100248101 12:92784811-92784833 CCTCGGAGAACCCTCTCTCCCAT 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG 0: 1
1: 0
2: 1
3: 54
4: 453
1100248103_1100248112 19 Left 1100248103 12:92784821-92784843 CCCTCTCTCCCATTCCATGGTTT 0: 1
1: 0
2: 2
3: 37
4: 390
Right 1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG 0: 1
1: 0
2: 1
3: 54
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100248112 Original CRISPR CCATCTACTCCCCTTGAAAT AGG Intronic
902769636 1:18638002-18638024 CCATCTAGTCTCCTTCCAATGGG - Intronic
903288667 1:22293304-22293326 TCATCCCCTCCCCTTGAATTGGG + Intergenic
903566937 1:24274739-24274761 CCATTCACTCCCCTGGAAAGGGG - Intergenic
906753257 1:48285417-48285439 CCATTCACTCCCCTGGAAAGGGG - Intergenic
907015159 1:51005374-51005396 CCATTTACTCCCCTGGAAAGGGG + Intergenic
907600099 1:55760531-55760553 CCATTCACTCCCCTGGAAAGGGG + Intergenic
908724104 1:67156799-67156821 CCATCCACTGCCCTGGAAAGGGG - Intronic
908923028 1:69219484-69219506 TCCTCTACTACCCTTAAAATTGG + Intergenic
909992491 1:82240137-82240159 CCATCTACTCCCATGGGAAGAGG - Intergenic
910065381 1:83144471-83144493 CTGTCTTCTCTCCTTGAAATTGG + Intergenic
910792288 1:91063984-91064006 CCTACTCCTCCCCTTGACATTGG + Intergenic
911284644 1:95974919-95974941 CCATCCACTCCCCTGGAAAGAGG - Intergenic
911958179 1:104263980-104264002 CCATCTCCTGACCTTGTAATCGG - Intergenic
912076750 1:105884677-105884699 CCATTCACTCCCCTGGAAAGGGG - Intergenic
912966222 1:114239729-114239751 CCATTCACTCCCCTGGAAAGGGG + Intergenic
915046116 1:153018431-153018453 CCATCCACTCCCATGGAAAGGGG + Intergenic
915654511 1:157348266-157348288 CCTTTCACTCCCCTTGAAAAAGG - Intergenic
915659330 1:157389134-157389156 CCATTCACTCCCATTGGAATGGG - Intergenic
916140524 1:161693299-161693321 CCATTCACTCCCCTGGAAAGGGG + Intergenic
916731620 1:167571901-167571923 CCATTCACTCCCCTGGAAAAGGG - Intergenic
916878746 1:168998560-168998582 CCATTCACTCCCCTGGAAAGCGG - Intergenic
916916078 1:169408070-169408092 CCATTCACTCCCCTGGAAAGGGG + Intronic
917401400 1:174653286-174653308 CCATACACTCCCCTGGAAAGGGG - Intronic
918167265 1:181961914-181961936 CCATTCACTCCCCTGGAAAGGGG - Intergenic
918501515 1:185201240-185201262 CCATTCACTCCCCTGGAAGTGGG - Intronic
919461691 1:197884507-197884529 CCATTCACTCCCCTGGAAAGGGG - Intergenic
920386382 1:205572636-205572658 CCAGCTTCTCCCCTTGAGCTGGG + Intronic
922380053 1:225013943-225013965 CCATTCACTCCCCTAGAAAGGGG - Intronic
922995970 1:229961928-229961950 TCATGTCCTCCCCTTGAAATGGG - Intergenic
923066993 1:230527259-230527281 CCATTCACTCCCCTGGAAAGGGG - Intergenic
923690935 1:236192313-236192335 CCATTCACTCCCCTGGAAAGGGG - Intronic
924083141 1:240420334-240420356 ACACCTACTCCTCTTTAAATTGG + Intronic
924380304 1:243456980-243457002 CAATCTGCTCCCCTAGAATTTGG - Intronic
924724272 1:246653812-246653834 TCATCTTCTCCCCTCCAAATTGG + Intronic
1062971801 10:1654149-1654171 ACATCAAATCCACTTGAAATGGG + Intronic
1063863523 10:10339457-10339479 ACATCTTCTTTCCTTGAAATTGG + Intergenic
1064757831 10:18587927-18587949 CCGTTTACTCCCCTGGAAAGGGG + Intronic
1066993518 10:42539693-42539715 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1067332294 10:45333613-45333635 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1067363983 10:45608091-45608113 CCATCTAGTCCCCTGGGAACTGG - Intergenic
1069264313 10:66438682-66438704 CCATTTACTCCGCTGGAAAGGGG - Intronic
1070632450 10:78096522-78096544 CCATTTACTCCCCCGGAAAGGGG + Intergenic
1071002043 10:80841738-80841760 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1071674782 10:87645156-87645178 TCATCTTCTCCCCTTGAAAGTGG - Intergenic
1072365382 10:94703723-94703745 CCATTCACTCCCCTGGAAAGGGG - Intronic
1072404383 10:95136334-95136356 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1072622818 10:97091257-97091279 CCATCTTCTCCCCTGGAGAGGGG + Intronic
1073884166 10:108019345-108019367 TCATTCACTCCCCTGGAAATGGG + Intergenic
1074795534 10:116939154-116939176 CCATTCACTCCCCTGGAAAGGGG - Intronic
1075257119 10:120934131-120934153 CCATCTGTACCCCTCGAAATGGG + Intergenic
1075591938 10:123698260-123698282 CCATTTCCTCCCCTCCAAATGGG + Intergenic
1076389774 10:130090565-130090587 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1077428333 11:2498673-2498695 TCATTTACTCCCCTGGAAAGGGG - Intronic
1077562074 11:3270409-3270431 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1077567968 11:3316229-3316251 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1077746636 11:4914410-4914432 ACTTCTTCTCCCCTTGAAACTGG - Intronic
1077879022 11:6333233-6333255 CCATCTCCTCACTGTGAAATGGG - Intergenic
1079158826 11:17974018-17974040 CCATCTACTAGCCTTGACAGTGG - Intronic
1079696099 11:23484173-23484195 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1079714879 11:23732049-23732071 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1079867884 11:25758443-25758465 CCATTCACTCCCCTGGAAAGAGG + Intergenic
1080117704 11:28639111-28639133 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1081080227 11:38732079-38732101 CCATTTGCTCCCCTGGAAAGGGG - Intergenic
1081118260 11:39232231-39232253 CCATTCACTCCCCTGGAAAAGGG + Intergenic
1082670681 11:56033277-56033299 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1083516245 11:63261806-63261828 CCATTCACTCCCCTGGAAAGGGG - Intronic
1084562625 11:69913134-69913156 CCATCTGCTGCCCATGCAATGGG + Intergenic
1085560404 11:77467252-77467274 GCATCTGCTGCACTTGAAATGGG - Intronic
1085850045 11:80109500-80109522 CCATCCACTCCCCTGGAAAAGGG + Intergenic
1086532389 11:87801173-87801195 CCATTCACTCCCCTGGAAAGTGG - Intergenic
1086608425 11:88725049-88725071 CCATTCACTCCCCTGGAAAGGGG + Intronic
1087596101 11:100256953-100256975 CCATTCACTCCCCTAGAAAGGGG + Intronic
1087695321 11:101369795-101369817 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1087703815 11:101466694-101466716 CCATTCACTCCCCTGGAAAGGGG - Intronic
1087712170 11:101567024-101567046 CCATTCACTCCCCTGGAAAGGGG + Intronic
1087811602 11:102614331-102614353 CCATCGCCTCCCCATGAAAAAGG - Intronic
1088020360 11:105111569-105111591 CCATCCACTCCCATGGAAAGGGG + Intergenic
1088078329 11:105878880-105878902 CCATTTACTCCTCTGGAAAGGGG - Intronic
1088294499 11:108277354-108277376 CCATTCACTCCCCTAGAAAGGGG - Intronic
1088307241 11:108423234-108423256 CCATTCACTCCCCTAGAAAGGGG + Intronic
1088702524 11:112426209-112426231 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1090307464 11:125703593-125703615 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1090318392 11:125818094-125818116 CCATTCACTCCCCTGGAAAGAGG + Intergenic
1090688845 11:129156243-129156265 CCATTTACTCCCCTGGAAAGGGG + Intronic
1090720386 11:129467200-129467222 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1090725123 11:129518090-129518112 CCATTCACTCCCCTGGAAAAGGG - Intergenic
1090896136 11:130977077-130977099 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1091090055 11:132762802-132762824 CCATTAACTCCCCTGGAAAGGGG - Intronic
1091213547 11:133885229-133885251 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1092398812 12:8153873-8153895 CCATTCACTCCCTTGGAAATGGG - Intronic
1093336069 12:17906041-17906063 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1094061106 12:26316295-26316317 CCATTCACTCCCCTGGAAAGAGG - Intergenic
1094733135 12:33200856-33200878 CCGTTTACTCCCCTGGAAAGGGG - Intergenic
1095488464 12:42708344-42708366 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1095831494 12:46591649-46591671 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1098840019 12:75467112-75467134 CCATATGCTCCCTTGGAAATGGG - Intergenic
1099071394 12:78049207-78049229 CCATCCACTCACCTGGAAAGGGG - Intronic
1099238952 12:80116038-80116060 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1099435289 12:82635152-82635174 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1099528154 12:83741157-83741179 CCATTTACTCCCTTGGAAAAAGG + Intergenic
1099798035 12:87422645-87422667 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1099897530 12:88667607-88667629 CCATTCACTCCCCTGGAAAGAGG + Intergenic
1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG + Intronic
1100740024 12:97581544-97581566 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1100768761 12:97898295-97898317 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1100892105 12:99137140-99137162 CCAAATACTGCCATTGAAATGGG + Intronic
1103223678 12:119267885-119267907 CCAACTACTCCCTTTGGAACAGG + Intergenic
1105769384 13:23594255-23594277 CCATTCACTCCCCTGGAAAGGGG + Intronic
1106336610 13:28789174-28789196 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1106377465 13:29203500-29203522 CCATTCACTCCCCTGGAAAGGGG - Intronic
1106426613 13:29636647-29636669 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1107289852 13:38839944-38839966 CCATTCACTCCCCTGGAAAGGGG - Intronic
1107314851 13:39119983-39120005 CCATCCACTCCCCCGGAAAGGGG - Intergenic
1107417031 13:40210340-40210362 CCATCAACTAACCTTGAAAAAGG + Intergenic
1107674105 13:42776939-42776961 CCATTTACTCCCCTGGAAAGGGG - Intergenic
1108470096 13:50758899-50758921 CAATCTTCTCCCCTTGAATGTGG - Intronic
1108674067 13:52721288-52721310 CCATTCACTCCCCTGGAAAGGGG - Intronic
1110135496 13:72062574-72062596 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1110824656 13:79958273-79958295 CCATTCCCTCCCCTGGAAATGGG + Intergenic
1110968637 13:81733047-81733069 CCATTCACTCCCCTGGAAAGAGG - Intergenic
1111056057 13:82952752-82952774 GCATCCACTCCCCTGGAAAGGGG + Intergenic
1111627927 13:90813345-90813367 CCGTTTACTCCCCTGGAAAAGGG + Intergenic
1111872664 13:93852973-93852995 CCATTTTATCCCCTTGAAATTGG - Intronic
1112546531 13:100376793-100376815 CCATTCACTCCCCTGGAAACGGG - Intronic
1114133585 14:19820918-19820940 CTATTCACTCCCCTGGAAATGGG - Intronic
1114341918 14:21754228-21754250 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1114433769 14:22686170-22686192 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1114710042 14:24768605-24768627 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1115008209 14:28511758-28511780 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1115345855 14:32342844-32342866 CTATGTAATCCCCTTGAATTAGG - Intronic
1115538025 14:34391670-34391692 CCATTCACTCCCCTGGAAAGGGG + Intronic
1115867258 14:37761003-37761025 CCACTTACTCCCCTGGAAAGGGG - Intronic
1115940359 14:38601805-38601827 CCATTCACTCCCCTGGAAAGAGG - Intergenic
1117073579 14:52078236-52078258 CCTTCTACTTCCCTAGAAGTAGG - Intergenic
1117237951 14:53798365-53798387 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1117299282 14:54407836-54407858 CCATTCACTCCCCTGGAAAGAGG - Intronic
1117599973 14:57365056-57365078 CCATTCACTCCCCTGGAAAGAGG + Intergenic
1117617104 14:57545047-57545069 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1117710672 14:58525712-58525734 CCATTTGCTCCCCTCGAAACAGG + Intronic
1117760407 14:59021232-59021254 GTTTCTCCTCCCCTTGAAATTGG - Intergenic
1117930566 14:60837210-60837232 CCATTCACTCCCCTGGAAAGGGG - Intronic
1117932211 14:60855301-60855323 CCATTCACTCCCCTGGAAAGGGG - Intronic
1118380705 14:65215241-65215263 CCCTCTACTCTTCTTGAATTAGG - Intergenic
1120773870 14:88411358-88411380 CCATTCACTCCCCTGGAAAGGGG - Intronic
1121245566 14:92458979-92459001 CCTTCTCCACCCCTTGAAGTGGG + Intronic
1121906574 14:97751641-97751663 CCAACTATGCCCATTGAAATTGG - Exonic
1123576653 15:21676487-21676509 CGATTCACTCCCCTGGAAATGGG - Intergenic
1123613275 15:22118955-22118977 CGATTCACTCCCCTGGAAATGGG - Intergenic
1124029136 15:25993649-25993671 GCATTTACTCCCCTCGAATTAGG + Intergenic
1124167675 15:27342623-27342645 CCAGCTTCTCCCCTTGAAAGAGG - Intronic
1125777558 15:42231137-42231159 CCATTTTCTCCCCTTGAGATGGG - Intronic
1126943679 15:53793406-53793428 CAGTGTACTCCCCTTCAAATTGG - Intergenic
1126952224 15:53893841-53893863 CCGTTCACTCCCCTTGAAAGGGG - Intergenic
1127158022 15:56149861-56149883 CCATTTACTCCCCTGGAAAGGGG + Intronic
1128863155 15:71091913-71091935 CCAACCACTCCACTTGCAATAGG - Intergenic
1129507984 15:76099069-76099091 CCATTCACTCCCCTGGAAAGGGG - Intronic
1129543767 15:76373616-76373638 CCATCTACTCCCCTGGCAACAGG + Intronic
1131410135 15:92200697-92200719 CACTCTACTTCCCTTTAAATTGG - Intergenic
1202985521 15_KI270727v1_random:410732-410754 CGATTCACTCCCCTGGAAATGGG - Intergenic
1137970013 16:52975556-52975578 CCGTTCACTCCCCTGGAAATGGG - Intergenic
1138706478 16:58920630-58920652 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1138843679 16:60539262-60539284 CCATTTACTCCCCTGGAAAGGGG - Intergenic
1138886888 16:61090921-61090943 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1140428385 16:74880496-74880518 CCATCTCCTCCCCTTCATAATGG - Intronic
1141681928 16:85549880-85549902 GCATCCCCTCCCCTTGAGATGGG - Intergenic
1144343174 17:14327386-14327408 CCATCTCCCCCCATTGAACTTGG - Intronic
1145258373 17:21340127-21340149 CAATCTCCTCCCTGTGAAATGGG + Intergenic
1145318255 17:21747879-21747901 CAATCTCCTCCCTGTGAAATGGG - Intergenic
1146746357 17:35333915-35333937 CCATACGCTCCCCTGGAAATGGG - Intergenic
1147986357 17:44309493-44309515 CGATCTTCTCCCCTTGAACCTGG - Intronic
1148967358 17:51447124-51447146 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1150090737 17:62322761-62322783 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1151064211 17:71131982-71132004 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1153697738 18:7661524-7661546 CCATTTACTAGCCTGGAAATTGG - Intronic
1153702588 18:7711484-7711506 CCATTCACTCCCCTGGAAAAGGG + Intronic
1154382255 18:13863226-13863248 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1155857366 18:30850261-30850283 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1156626887 18:38920240-38920262 CCATTCACTCCCCTAGAAAGGGG - Intergenic
1157063947 18:44325189-44325211 CCATCTACTCTCCTGGAAACTGG + Intergenic
1157547455 18:48556403-48556425 CCATCACCTCCCCTTGCATTGGG - Intronic
1158853348 18:61517771-61517793 CCATTCACTCCCCTGGAAAAGGG + Intronic
1158891040 18:61871917-61871939 CCATATACTGCCCTTAATATAGG - Intronic
1159319428 18:66827911-66827933 AATTCTACTCCCCTTGAAAATGG - Intergenic
1159385993 18:67726023-67726045 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1159690617 18:71482997-71483019 CCATTCACTCCCCTGGAAAACGG - Intergenic
1159957640 18:74530992-74531014 CCATTTACTTCCCTGGAAAGAGG - Intergenic
1164047563 19:21555616-21555638 CCCTTTACTCCCCTAGAAAGGGG - Intronic
1165269871 19:34696808-34696830 CCATACACTCCCCTGGAAAGGGG + Intergenic
1165350669 19:35273452-35273474 CCATCTACTCACTTGGAACTGGG - Intronic
1168530883 19:57127766-57127788 CCATTCACTCCCCTGGAAAGGGG - Intronic
926944005 2:18168181-18168203 CCATTCACTCCCCTGGAAAGAGG - Intronic
927117129 2:19916390-19916412 CCATTCACTCCCCTGGAAAGGGG + Intronic
927396110 2:22653974-22653996 CCATCTCCTCCCATGCAAATAGG + Intergenic
928539204 2:32268547-32268569 CCATCCTCACCCCTTAAAATTGG + Intergenic
928576738 2:32663164-32663186 CCATTCACTCCCCTGGAAAGGGG - Intronic
930305852 2:49673563-49673585 CAATCTTCTCCCCTTGAATTCGG - Intergenic
930359301 2:50358232-50358254 CCATTCACTCCCCTGGAAAGGGG + Intronic
930363301 2:50409022-50409044 CCCTCCCCTCCCCTTGAAAAAGG - Intronic
930439897 2:51391826-51391848 CCATTCACTCCCCTGGAAAGGGG + Intergenic
931212113 2:60207319-60207341 CCATTCACTCCCCTGGAAAGGGG - Intergenic
931328450 2:61253523-61253545 CCAACTACCCTTCTTGAAATTGG + Intronic
931886725 2:66625965-66625987 CCATTCACTCCCCTGGAAACGGG - Intergenic
933324215 2:80815284-80815306 CCGTCCACTCCCCTGGAAAGGGG + Intergenic
933355619 2:81206222-81206244 CCGTTTACTCCCCTGGAAAGGGG + Intergenic
933413229 2:81951193-81951215 CCATTCACTCCCCTGGAAAGGGG - Intergenic
934073689 2:88409181-88409203 CCATCTACTACCATATAAATAGG - Intergenic
934871789 2:97872894-97872916 CCATTCACTCCCCTGGAAAGGGG + Intronic
935852231 2:107235466-107235488 CCGTCCACTCCCCTGGAAAGGGG + Intergenic
937289594 2:120774050-120774072 CCTGCTCCTCACCTTGAAATTGG - Intronic
937619191 2:123966124-123966146 CCTTCTACTCACCTTGCCATTGG + Intergenic
937860774 2:126707329-126707351 GCATCTATTCCCATTGAAGTAGG + Intergenic
938224302 2:129602583-129602605 CCATCAACTGCCCTGGAAAGGGG - Intergenic
938568132 2:132539050-132539072 CCATCCACACCCCTGGAAAGGGG - Intronic
938949681 2:136244902-136244924 CCATTTATTCACCTTTAAATGGG - Intergenic
939840585 2:147182660-147182682 CCATTCACTCCCCTGGAAAGAGG + Intergenic
940145424 2:150540931-150540953 GCATCTACACCACTAGAAATTGG + Intergenic
940594031 2:155767059-155767081 CCATTTACTCCCCTGGAAAGGGG - Intergenic
940602580 2:155880360-155880382 CCATTCACTCCCCTGGAAAGAGG + Intergenic
940821379 2:158359826-158359848 CCATTCACTCCCCTGGAAAGGGG + Intronic
940925150 2:159356140-159356162 CCATTCACTCCCCTGGAAAGGGG + Intronic
941575321 2:167222703-167222725 CCATCTACTCAACTTTAAAAGGG + Intronic
941845267 2:170126055-170126077 CCATTCACTCCCCTGGAAAGGGG + Intergenic
942010888 2:171761523-171761545 CCATTCACTCCCCTGGAAAGGGG - Intergenic
942080618 2:172396448-172396470 GCATCTTCTCTCCTTGAGATGGG - Intergenic
942411013 2:175709270-175709292 CCATTCACTCCCCTGGAAATGGG + Intergenic
943085026 2:183300792-183300814 CCATTCACTCCCCTGGAAAAAGG - Intergenic
943284143 2:185975830-185975852 CTATATAATCCCCTTGAGATTGG + Intergenic
944146210 2:196510126-196510148 CCATCCACTCCCATTCAGATGGG + Intronic
945409146 2:209488438-209488460 CCATTCACTCCCCTGGAAAGGGG + Intronic
945486925 2:210407180-210407202 CCATTCACTCCCCTGGAAAGGGG - Intergenic
945945170 2:215988545-215988567 TCATTTACTCCCCTGGAAAGGGG + Intronic
946912965 2:224485270-224485292 CCGTCCACTCCCCTGGAAAGGGG + Intronic
947311595 2:228809325-228809347 CCATCCACTCCCCTGAAAAGGGG - Intergenic
948175550 2:235939877-235939899 CCCTGCACTCCTCTTGAAATAGG + Intronic
948175826 2:235942018-235942040 CCCTGCACTCCTCTTGAAATAGG + Intronic
1169004906 20:2198631-2198653 CCATCTCCTCATCCTGAAATAGG + Intergenic
1169320073 20:4625311-4625333 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1169379654 20:5095632-5095654 CCATCTCCTCACCTTGAGACTGG - Intronic
1169984128 20:11423112-11423134 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1170133885 20:13052543-13052565 CCATTCACTCCCCTGGAAAGGGG + Intronic
1170294212 20:14806592-14806614 CCATTCACTCCCCTGGAAAGGGG + Intronic
1170727364 20:18941844-18941866 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1171000828 20:21413986-21414008 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1173318665 20:41968161-41968183 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1174214569 20:48906180-48906202 ACATCCCCTCCCCTTGAAACTGG - Intergenic
1175040932 20:56050018-56050040 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1178033444 21:28554875-28554897 CCATCCACTCCCATGGAAACGGG + Intergenic
1182912142 22:33993641-33993663 CCATCTATTCCACTTGGATTTGG - Intergenic
1182952520 22:34390799-34390821 CCGTTTACTCCCCTGGAAAGGGG - Intergenic
949226947 3:1705836-1705858 CCATTCACTCCCCTGGAAAAGGG + Intergenic
951538632 3:23761966-23761988 CCATCTGCTCCCCAAGAAGTGGG + Intergenic
951795511 3:26533989-26534011 CCATTCACTCCCCTGGAAAGGGG - Intergenic
953555807 3:43946047-43946069 CCATTCACTCCCCTGGAAAAGGG - Intergenic
954978712 3:54723381-54723403 CCATTCACTCCCCTGGAAAGGGG - Intronic
955414320 3:58678584-58678606 CCATTCACTCCCCTGGAAAGGGG - Intergenic
955657856 3:61263797-61263819 CCATTCACTCCCCTGGAAAGGGG - Intergenic
956039180 3:65128359-65128381 TTCTCTACTCCCCTTGAGATGGG + Intergenic
957249643 3:77756896-77756918 CCATTCACTCCCCTGGAAAAAGG + Intergenic
957474822 3:80709582-80709604 CCATTCACTCCCCTGGAAAGGGG + Intergenic
957695688 3:83635865-83635887 CCATTCACTCCCCTGGAAAGAGG + Intergenic
958176695 3:90004437-90004459 CCACCTACTCTCCTTAAATTGGG - Intergenic
958694592 3:97511165-97511187 CCATTCACTCCCCTGGAAAGGGG - Intronic
960494978 3:118362621-118362643 CCAATTATTCCCATTGAAATTGG + Intergenic
962850582 3:139305779-139305801 GCATTTACTCCCCTTGAATCTGG + Intronic
964232458 3:154486932-154486954 CCATTCACTCCCCTGGAAAGGGG + Intergenic
964371388 3:156004075-156004097 CCATTCACTCCCCTGGAAAGGGG - Intergenic
965621970 3:170651149-170651171 CCGTCCACTCCCCTGGAAAGGGG - Intronic
965880432 3:173382302-173382324 CCATTCACTCCCCTAGAAAGGGG + Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
966561477 3:181325227-181325249 CCATTCACTCCCCTGGAAAGGGG - Intergenic
969164836 4:5298777-5298799 CCATTCACTCCCCTGGAAAGGGG - Intronic
969513028 4:7630462-7630484 CCCTCTCCTCACCTTCAAATTGG - Intronic
969648371 4:8447576-8447598 CTGTCTACTCACCTTGAAATGGG + Intronic
970784485 4:19780069-19780091 CCATTCACTCCCCTGGAAATGGG - Intergenic
971253497 4:24992819-24992841 CCACATGCTCTCCTTGAAATGGG + Intergenic
971673628 4:29595664-29595686 CCATTGACTCCCCTGGAAAGGGG - Intergenic
972372483 4:38438201-38438223 CCATTCACTCCCCTGGAAAGGGG - Intergenic
972576227 4:40354402-40354424 CCATTCACTCCCCTTGGAATTGG - Exonic
973081882 4:46003263-46003285 CCATTCACTCCCCTGGAAAGAGG - Intergenic
973562623 4:52151650-52151672 CCATTCACTCCCCTGGAAAAGGG + Intergenic
973715247 4:53669805-53669827 CCATTCACTCCCCTGGAAAGAGG - Intronic
974106259 4:57472859-57472881 CCATCCACTTCCCTGGAAAGGGG - Intergenic
974192200 4:58520037-58520059 CCAACTTCTCCACTTGTAATAGG - Intergenic
974560063 4:63506097-63506119 CCATTCACTCCCCTGGAAAGGGG + Intergenic
975524223 4:75331451-75331473 CCATTCACTCCCCTGGAAAAGGG + Intergenic
975764658 4:77654897-77654919 CCATTCACTCCCCTGGAAAGCGG + Intergenic
976023962 4:80664717-80664739 CCATTCACTCCCCTGGAAAGGGG - Intronic
976438266 4:85043797-85043819 CCATTCACTCCCCTGGAAAAGGG + Intergenic
976439260 4:85054950-85054972 CCATTCACTCCCCTGGAAAGGGG + Intergenic
977500247 4:97828545-97828567 CCATTCACTCCCCTGGAAAGGGG + Intronic
977774402 4:100900597-100900619 CCATTCACTCCCCTGGAAAGGGG + Intergenic
977792915 4:101128899-101128921 CCATTCACTCCCCTGGAAAGGGG + Intronic
977994431 4:103484908-103484930 CCATTTACTCCCCTGGAAAGGGG + Intergenic
978186085 4:105858398-105858420 CCATTCACTCCCCTGGAAAGGGG - Intronic
978503962 4:109436739-109436761 CTATCCACTCCCCTTCAAAGGGG - Intronic
979115256 4:116815249-116815271 CCATTCACTCCCCTCGAAAGGGG + Intergenic
979119779 4:116883343-116883365 CCATTCACTCCCCTGGAAAGGGG - Intergenic
980223332 4:129947954-129947976 CGATTTACTCCCCTAGAAAGAGG - Intergenic
980623668 4:135344332-135344354 CTACCTACACCCCTTGGAATAGG + Intergenic
980855206 4:138431575-138431597 CTATCTACTCCCCTGGAAAGGGG + Intergenic
981273150 4:142867872-142867894 CCATTCACTCCCCTGGAAAGGGG + Intergenic
981411232 4:144435080-144435102 CCATTCACTCCCCTAGAAAGAGG + Intergenic
981859874 4:149341523-149341545 CCATTTACTCCCCTGGAAAGGGG - Intergenic
981885312 4:149666579-149666601 CCGTTTACTCCCCTGGAAAGGGG + Intergenic
982815414 4:159877895-159877917 CCATTCACTCCCCTGGAAATGGG - Intergenic
983840835 4:172455360-172455382 CCATTCACTCCCCTGGAAAGGGG + Intronic
983958829 4:173727936-173727958 CCATTCACTCCCCTGGAAAGGGG - Intergenic
985600038 5:823514-823536 CCATCGCCTCCCCTTGGAGTGGG - Intronic
986006041 5:3669901-3669923 CCATTCACTCCCCTGGAAAGGGG - Intergenic
986511955 5:8517142-8517164 CCATCCATTCCCCTGGAAAGGGG - Intergenic
986879565 5:12153653-12153675 CCATTCACTCCCCTGGAAAGGGG + Intergenic
987019235 5:13852521-13852543 CCATTCACTCCCCTGGAAAGGGG + Intronic
987924105 5:24317957-24317979 CCATTCACTCCCCTGGAAAGGGG - Intergenic
988402081 5:30775586-30775608 CCATTCACTCCCCTGGAAAGGGG + Intergenic
988772607 5:34447789-34447811 CCATTCACTCCCCTGGAAAGGGG - Intergenic
988867726 5:35354030-35354052 CCATTCACTCCCCTAGAAAGGGG - Intergenic
990098835 5:52156794-52156816 CTATTTACTCCCCTGGAAAGGGG + Intergenic
990673907 5:58162309-58162331 CCATTCACTCCCCTGGAAAAGGG - Intergenic
990697586 5:58438053-58438075 CCATGTACTTCCCTTGAATGAGG + Intergenic
992254904 5:74911755-74911777 CCATTCACTCCCCTGGAAAGGGG - Intergenic
992740644 5:79770291-79770313 CCATTCACTCCCCTGGAAAGGGG - Intronic
993020477 5:82585006-82585028 CCATCCACTCCCATGGAAAGGGG - Intergenic
993757648 5:91751201-91751223 CCATCAACTCCCCTGGAAAGGGG - Intergenic
994468276 5:100167350-100167372 CCATCTAACTCCCTGGAAATAGG - Intergenic
995093933 5:108213281-108213303 CCATTCACTCCCCTGGAAAGGGG - Intronic
995111834 5:108437414-108437436 CCATTCACTCCCCTGGAAAGGGG + Intergenic
996426644 5:123320316-123320338 CCATTCACTCCCCTGGAAAAAGG - Intergenic
996910908 5:128655961-128655983 CCATTCACTCCCCTGGAAAGGGG - Intronic
996985412 5:129556578-129556600 CAATCAACTGACCTTGAAATAGG + Intronic
997216620 5:132116912-132116934 CCATTCACTCCCCTGGAAAGGGG + Intergenic
997217871 5:132129407-132129429 CCGTCCACTCCCCTAGAAAGGGG - Intergenic
998691647 5:144594729-144594751 CCATTTACTCCCCTGGAAAGGGG - Intergenic
999468644 5:151831301-151831323 CCATTCACTCCCCTGGAAAGGGG + Intronic
999502406 5:152160296-152160318 CCATTCACTCCCCTGGAAAGGGG - Intergenic
999556785 5:152752104-152752126 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1000820216 5:165973636-165973658 CCATGCACTCCCCTGGAAAGGGG - Intergenic
1002677142 5:180926474-180926496 CCATTCACTCCCCTGGAAAGGGG + Intronic
1002787836 6:417868-417890 CCCTCTCCTTCCCTTGAACTGGG - Intergenic
1002842402 6:917613-917635 CCATCTCCTCCTCTTGACAGGGG - Intergenic
1002996091 6:2286677-2286699 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1006199936 6:32279368-32279390 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1006600910 6:35225234-35225256 CCATCTCCTCCCCCTTAAAATGG - Intronic
1008044601 6:46838832-46838854 CCATATACAGCTCTTGAAATGGG + Intronic
1008896864 6:56566184-56566206 CCATTCACTCCCCTGGAAAGGGG - Intronic
1009458738 6:63887809-63887831 CCATTCACTCCCCTGGAAAGGGG + Intronic
1009570157 6:65374554-65374576 CCATTTACTCCCCTGGAAAGTGG + Intronic
1009709647 6:67300622-67300644 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1009718280 6:67428363-67428385 CCATCCACTCCCCTGGAAAGGGG - Intergenic
1009727889 6:67558330-67558352 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1010459446 6:76097698-76097720 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1010668333 6:78655815-78655837 CCATTCACTCCCCTGGAAAAGGG - Intergenic
1010993983 6:82512431-82512453 CCATTCACTCCCCTGGAAAAGGG + Intergenic
1011120060 6:83942615-83942637 CCATTCACTCCCCTGGAAAGGGG + Intronic
1011302668 6:85892621-85892643 CCATTCACTCCCCTAGAAAGGGG - Intergenic
1011387706 6:86815620-86815642 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1011831265 6:91374698-91374720 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1012083097 6:94785428-94785450 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1012701128 6:102458757-102458779 CCATCTACTTCCTTGGAAAGGGG + Intergenic
1012777967 6:103522023-103522045 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1012870867 6:104671231-104671253 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1013452969 6:110303316-110303338 CCATTCACTCCCCTGGAAAAGGG + Intronic
1013672598 6:112421533-112421555 CCACTTACTCCCCTGGAAAGAGG + Intergenic
1013718632 6:112995031-112995053 CCTACTCCTCCCCTGGAAATTGG + Intergenic
1013956891 6:115852453-115852475 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1014122853 6:117746178-117746200 CCGTTTACTCCCCTGGAAAGAGG + Intergenic
1014223568 6:118823095-118823117 CCATTCACTCCCCTGGAAAGGGG - Intronic
1014527846 6:122522370-122522392 CCATTCACTCCCCTGGAAAGGGG - Intronic
1014836576 6:126167103-126167125 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1014922408 6:127228640-127228662 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1015291050 6:131538714-131538736 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1015802051 6:137070285-137070307 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1016111447 6:140230286-140230308 CCATTTACTCCCCTAGAAAGGGG + Intergenic
1016483515 6:144508226-144508248 CCATTCACTCCCCTGGAAAGGGG - Intronic
1017163270 6:151385601-151385623 CCTTTTAGTGCCCTTGAAATGGG - Intronic
1017968730 6:159290523-159290545 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1019107637 6:169681976-169681998 CCAACTCCTCCTGTTGAAATCGG + Intronic
1019303883 7:323050-323072 CCATCCACTCCCCTTGAGGGAGG + Intergenic
1019919952 7:4157223-4157245 CCAGCTACTCCACATGCAATGGG - Intronic
1019975641 7:4579196-4579218 GCATCTTCTCCCCTTGAAACTGG + Intergenic
1020519613 7:9169377-9169399 CCATTCACTCCCCTGGAAATGGG - Intergenic
1020736834 7:11960780-11960802 CCATATAATCCCCTTTAAATTGG + Intergenic
1020823870 7:13002951-13002973 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1021483919 7:21146689-21146711 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1022848485 7:34235624-34235646 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1022869087 7:34457368-34457390 CCATTCACTCCCCTGGAAAAGGG + Intergenic
1022920567 7:35009656-35009678 CCATCTACAGCCATTGACATTGG + Intronic
1023697792 7:42865418-42865440 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1024495421 7:50040809-50040831 CCATTCACTCCCCTGGAAAGGGG + Intronic
1027278726 7:76590277-76590299 CTGTCTTCTCTCCTTGAAATTGG - Intergenic
1027582853 7:80020277-80020299 CCCTCCACTCCCCTGGAAAGGGG + Intergenic
1028145903 7:87319504-87319526 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1028652871 7:93170399-93170421 CCATTCACTCCCCTAGAAAGAGG - Intergenic
1028720717 7:94027794-94027816 CAATCAACTCACCTTAAAATAGG + Intergenic
1030159517 7:106493024-106493046 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1030500841 7:110356771-110356793 CCGTTTACTCCCCTGGAAAGGGG - Intergenic
1030705656 7:112690152-112690174 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1030771130 7:113475898-113475920 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1031031814 7:116743379-116743401 CCATTCACTCCCCTGGAAAGGGG + Intronic
1031613795 7:123857172-123857194 CCATTCACTCCCCTGGAAAGGGG - Intronic
1034097655 7:148424860-148424882 CCATTAACTCCCCCGGAAATGGG + Intergenic
1035794040 8:2337064-2337086 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1035798765 8:2384644-2384666 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1037719625 8:21431506-21431528 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1040736533 8:50515454-50515476 CCATTCACTCCCCTGGAAAGGGG + Intronic
1040779871 8:51095124-51095146 CCATTTGCTCCCCTAGAAAGTGG + Intergenic
1040968833 8:53112472-53112494 CCATTTACTCCCCTGGAAAGGGG - Intergenic
1041362684 8:57069398-57069420 CCATATACTACCCTGGAAAGAGG - Intergenic
1041481946 8:58331890-58331912 CCATCCACTCCCATGGAAATGGG + Intergenic
1041836612 8:62223577-62223599 CCATACACTCCCCTGGAAAGGGG + Intergenic
1041900655 8:62978704-62978726 CCATTCACTCCCCTGGAAAGGGG - Exonic
1042946162 8:74156656-74156678 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1043302375 8:78749920-78749942 CCAGCTACTCAGGTTGAAATAGG + Intronic
1043368293 8:79560641-79560663 CCATCCACTCCCTTGGAAAGGGG - Intergenic
1043511310 8:80952824-80952846 CCATTCACTCCCCTTGAAAGGGG + Intergenic
1043532406 8:81165805-81165827 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1043780383 8:84326902-84326924 CCATGTACTTGTCTTGAAATAGG + Intronic
1044312399 8:90709024-90709046 CCATTCACTCCCCTAGAAAGAGG - Intronic
1044751142 8:95416738-95416760 TCAGCTACTCACCTTCAAATAGG - Intergenic
1044835360 8:96290071-96290093 CCATCTCCTCCCCTGTAAAATGG - Intronic
1044960993 8:97530311-97530333 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1045151811 8:99416406-99416428 CCATTTGCTCCCCTGGAAAGGGG - Intronic
1045199645 8:99967383-99967405 CCATTCACTCCCCTGGAAAGGGG + Intronic
1045390556 8:101710416-101710438 CCATTCACTCCCCTGGAAAGGGG + Intronic
1045783656 8:105897125-105897147 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1046153503 8:110257867-110257889 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1046854491 8:119015732-119015754 CAAACTACTGCCCCTGAAATTGG - Intronic
1046972566 8:120238596-120238618 CCATTCACTCCCCTGGAAAGGGG - Intronic
1047047851 8:121074713-121074735 CCATCTACCCCCACTCAAATAGG - Intergenic
1048190438 8:132283220-132283242 CCATTTACTCCTCTGGAAAATGG - Intronic
1048914149 8:139165662-139165684 CCATTTACTCCCCTGGAAAGGGG - Intergenic
1050234417 9:3562870-3562892 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1050450814 9:5779649-5779671 CCATTCACTCCCCTGGAAAGGGG + Intronic
1052329356 9:27251648-27251670 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1052336419 9:27324601-27324623 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1052506337 9:29359093-29359115 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1053652987 9:40188071-40188093 CCATATACAGCACTTGAAATGGG - Intergenic
1053903392 9:42817379-42817401 CCATATACAGCACTTGAAATGGG - Intergenic
1054531596 9:66188150-66188172 CCATATACAGCACTTGAAATGGG + Intergenic
1055386852 9:75771865-75771887 CCATTTACTCCCCTGGAAAGGGG - Intergenic
1055682228 9:78727647-78727669 CCATCTACTAACTTTGAATTTGG - Intergenic
1059205625 9:112462059-112462081 CCATCTGCTTTCCTTTAAATGGG + Intronic
1061944709 9:133902146-133902168 CCATCAGCTCCCCCTGCAATTGG + Intronic
1062453253 9:136624264-136624286 CCATGTTCTCCCTTTGAATTTGG + Intergenic
1062625265 9:137439581-137439603 TCATCTACCCTCCTTAAAATGGG - Intronic
1185911124 X:3982169-3982191 CCACTTACTCCCCTGGAAAGGGG + Intergenic
1186599828 X:11024784-11024806 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1186916574 X:14229190-14229212 ACATCTATTTCCCTTGAAGTAGG - Intergenic
1187140304 X:16586824-16586846 CCATCCTGTCCCCTTGAACTTGG - Intergenic
1188161481 X:26809599-26809621 CCATCTACTCCACTTGGAAGAGG + Intergenic
1188561266 X:31471139-31471161 CCATTCACTCCCCTGGAAAGGGG - Intronic
1188611296 X:32101490-32101512 CTATTTTCTCCCCTTGCAATTGG + Intronic
1189039786 X:37530446-37530468 CCATTCACTCCCCTGGAAAGGGG - Intronic
1190966440 X:55305707-55305729 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1190995710 X:55606481-55606503 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1191005052 X:55702574-55702596 CCATCCACTCCCCTGGAAAGGGG + Intergenic
1191088737 X:56597654-56597676 CCATTCACTCCCCTGGAAAAAGG - Intergenic
1191094372 X:56659140-56659162 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1191119724 X:56890774-56890796 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1191130728 X:57007000-57007022 CCATCTAATCCACTTAAAATGGG - Intergenic
1191186658 X:57620643-57620665 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1191222326 X:58002897-58002919 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1191650942 X:63537166-63537188 CCATCCACTCCCATGGAAAGGGG + Intergenic
1191908975 X:66127209-66127231 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1191947730 X:66553947-66553969 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1191969646 X:66799183-66799205 CCATTTACTCCCCTGGAAAGAGG + Intergenic
1191972942 X:66838059-66838081 CTGTCCACTCCCCTTGAAAGGGG + Intergenic
1192064298 X:67864725-67864747 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1192759214 X:74078040-74078062 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1192878561 X:75258274-75258296 CCATTCACTCCCCTGGAAAGAGG + Intergenic
1192884294 X:75320540-75320562 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1192931778 X:75814350-75814372 CCGTTTACTCCCCTGGAAAGGGG + Intergenic
1192953199 X:76039603-76039625 CCATTCACTCCCCTGGAAAACGG - Intergenic
1192971281 X:76233797-76233819 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1193040484 X:76998967-76998989 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1193113789 X:77756335-77756357 CCATTCACTCCCCTGGAAAGGGG - Intronic
1193161392 X:78233050-78233072 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1193254051 X:79325650-79325672 CCATTCACTCCCCTGGAAACAGG - Intergenic
1193382198 X:80828175-80828197 ACACTTACTCCCCTGGAAATGGG - Intergenic
1193547991 X:82852775-82852797 CCATTCACTCCCCTGGAAAAGGG - Intergenic
1193637404 X:83969227-83969249 CCATGTATTCCCCTTGGAAGGGG + Intergenic
1194242540 X:91469932-91469954 CCATTCACTCCCCTGGAAAGAGG + Intergenic
1194771776 X:97915411-97915433 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1194783149 X:98049344-98049366 CCATTCACTCCCCTGGAAAGAGG - Intergenic
1194798419 X:98240827-98240849 CCATTCACTCCCCTCGAAAGGGG - Intergenic
1194954440 X:100162563-100162585 CCGTTTACTCCCCTGGAAAGGGG - Intergenic
1194961070 X:100236452-100236474 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1195140077 X:101950334-101950356 CCGTTTACTCCCCTGGAAAGGGG + Intergenic
1195435941 X:104843393-104843415 CCATCCACTCCCCTGGAAAGGGG - Intronic
1195730302 X:107959917-107959939 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1196273186 X:113735988-113736010 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1196312359 X:114183635-114183657 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1196946617 X:120833050-120833072 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1197051164 X:122061185-122061207 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1197184721 X:123573646-123573668 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1197191070 X:123648465-123648487 CCATCCACTCCCCTGGAAAGGGG + Intronic
1198259227 X:134951230-134951252 CCATTCACTCCCCTGGAAAAGGG + Intergenic
1198518969 X:137433529-137433551 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1199477386 X:148260393-148260415 CCATTCACTCCCCTGGAAAGGGG - Intergenic
1200046450 X:153405351-153405373 CCAGCTACACCTCTTGAAAGGGG - Intergenic
1200333202 X:155319712-155319734 CCATTCACTCCCCTGGAAAGGGG + Intronic
1200365429 X:155657600-155657622 CCATTCACTCCCCTGGAAAGGGG - Intronic
1200664105 Y:5999106-5999128 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1200713452 Y:6510700-6510722 ACATTTACTCCCTTTGAACTTGG + Intergenic
1201020477 Y:9651341-9651363 ACATTTACTCCCTTTGAACTTGG - Intergenic
1201511527 Y:14769701-14769723 CCATTTACTCTCCTGGAAAGAGG + Intronic
1201644078 Y:16208278-16208300 GCATCAACTCCCCTTGAAAGTGG + Intergenic
1201658737 Y:16377043-16377065 GCATCAACTCCCCTTGAAAGTGG - Intergenic
1201946358 Y:19514951-19514973 CCATTCACTCCCCTGGAAAGGGG + Intergenic
1202096315 Y:21251281-21251303 CCATTTACTCCCCTGGAAAGAGG - Intergenic