ID: 1100258387

View in Genome Browser
Species Human (GRCh38)
Location 12:92907382-92907404
Sequence TCTGAGATGGAGAATGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 344}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100258387_1100258390 17 Left 1100258387 12:92907382-92907404 CCATCTACATTCTCCATCTCAGA 0: 1
1: 0
2: 1
3: 35
4: 344
Right 1100258390 12:92907422-92907444 ACTCATTTTGCCTAAATCCAAGG 0: 1
1: 0
2: 1
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100258387 Original CRISPR TCTGAGATGGAGAATGTAGA TGG (reversed) Intronic
901080493 1:6581134-6581156 TCTGAGCTGGGGAATGGAGCTGG - Exonic
904256276 1:29257042-29257064 TCAGAGATGGAGAGAGGAGAAGG + Intronic
904585782 1:31579786-31579808 TCTGAGATGGGAAGTGGAGAAGG + Intronic
905879697 1:41455574-41455596 TCTGAGATGGGGACTGCAGCAGG - Intergenic
906504381 1:46367212-46367234 TTGGAGATGAAGAATGCAGATGG - Intergenic
908403465 1:63791831-63791853 TCTGAGATCGAGGATTTAGATGG + Intronic
909825540 1:80121798-80121820 TCTGAGGAGGAGAATGTATTGGG - Intergenic
912094618 1:106122239-106122261 TCTATCATGGAGAATGCAGAGGG + Intergenic
912240657 1:107904401-107904423 TTTCAGTTGGATAATGTAGATGG - Intronic
912373765 1:109193596-109193618 TCTCAGATGCAGAAAGTACATGG - Intronic
912528431 1:110302682-110302704 TGTGGGATGGAGAATGTGGGAGG + Intergenic
913365476 1:118033307-118033329 ACTGAAATTGAGAATGTAGGAGG - Intronic
913517952 1:119621243-119621265 GCTGAGCTGGAGAATGCAAAAGG + Exonic
913536706 1:119779888-119779910 TCTGAGAGGGAGGAAGCAGAGGG + Intergenic
915808665 1:158882028-158882050 TGAGAGAGAGAGAATGTAGATGG - Intergenic
917733526 1:177899759-177899781 TCAGAGATGGAGGAGGAAGAGGG + Intergenic
917750690 1:178050592-178050614 TTTGAGCTGGAGAATGATGAGGG + Intergenic
918427451 1:184425207-184425229 ACTGAGATGGTGTATGTGGAAGG + Intronic
918564131 1:185906855-185906877 CCTGATATGGAGACTGAAGAGGG - Intronic
919277039 1:195433787-195433809 TTTGAAATGGACAAGGTAGAGGG - Intergenic
920048117 1:203146717-203146739 TCTGAGATGGAGAGTGCTGTGGG + Intronic
920058035 1:203206744-203206766 TCTGAGATGCAGAATGAAAAAGG - Intergenic
921389036 1:214601089-214601111 TCTGAGAGTAAGAATGGAGATGG + Intergenic
921421110 1:214949444-214949466 TCTGAGAAGGATTATGAAGAGGG + Intergenic
923860337 1:237886506-237886528 GCTGAAATGTAGAATGGAGAAGG + Intronic
924406046 1:243747141-243747163 TTAGAGATAGAGAGTGTAGATGG + Intronic
1063097084 10:2917785-2917807 TCTGATATGGAGGAGGGAGAGGG - Intergenic
1063373683 10:5538814-5538836 TCTGAGACGCAGAATGTACCTGG - Intergenic
1064924442 10:20554739-20554761 TCTGAGAAGGAGAAGGATGAAGG - Intergenic
1065201685 10:23318416-23318438 TCAGGGAGGGACAATGTAGAGGG + Exonic
1068522052 10:58087655-58087677 GCAGAGATGGAGGATGTGGAAGG - Intergenic
1071868224 10:89762081-89762103 TCTGAGATGGGGCATTTTGAGGG + Intronic
1071868889 10:89769779-89769801 TCTGGCATGTAGAATGTGGAAGG + Intronic
1072843328 10:98799378-98799400 TCTCAGATGGAAAATCAAGAAGG + Intronic
1073571504 10:104584302-104584324 TCAGTGATGGAGACTGAAGAGGG + Intergenic
1073718850 10:106141754-106141776 TCTAAGATGGATACTTTAGAAGG + Intergenic
1073968395 10:109017869-109017891 TCTGAGTTTGAGATTATAGAAGG - Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1075801611 10:125158415-125158437 TCTGACATGGATAATTTTGAGGG - Intronic
1077866402 11:6224880-6224902 TTTGAGATGGAGAAAGTTGAAGG - Intronic
1078124210 11:8543557-8543579 TCATAGATGTAGAAAGTAGAAGG + Intronic
1078450906 11:11440170-11440192 TCTGCTATGTAAAATGTAGACGG + Intronic
1080299921 11:30772442-30772464 TCTGAGATGTTTAATGAAGAAGG - Intergenic
1080460433 11:32450215-32450237 TGTGAGATGGAAGGTGTAGAAGG - Intergenic
1081772247 11:45657160-45657182 TCTAGGATGGAGACTGCAGAGGG + Intronic
1082180235 11:49108080-49108102 TGTGAATTGGTGAATGTAGAAGG + Intergenic
1082753482 11:57047706-57047728 TCTGAGAATGACAATGGAGAGGG - Intergenic
1083430244 11:62610690-62610712 ACTGAGATGGAGGAGGTCGAGGG + Intronic
1083675321 11:64321900-64321922 GCTGAAAGGGAGAATGTAGGGGG + Intergenic
1086461787 11:87013068-87013090 TCTGAGAGGCACAATGTGGATGG - Intergenic
1087705024 11:101480341-101480363 TCTAAGAGGGAGAATATAGAAGG - Intronic
1087705131 11:101481545-101481567 TCTAAGAGGGAGAATACAGAAGG - Intronic
1088420738 11:109643224-109643246 TCTTAGATGGAAAATGGGGAAGG + Intergenic
1088793482 11:113247537-113247559 TCAGAGATGGGAAATGTGGAGGG - Intronic
1088900446 11:114112403-114112425 TGAGAGATGGAGAAGGTAGAGGG + Intronic
1089074745 11:115729036-115729058 TCTTAGATGGAGAAGGAAGTGGG + Intergenic
1089644669 11:119870891-119870913 TCTAAGAAGGAGAATAAAGAAGG + Intergenic
1089813225 11:121148472-121148494 TCTGAGATTCAAAATGTAAAAGG - Intronic
1090239064 11:125169329-125169351 ACTGAGAAGCAGAATTTAGAGGG + Intronic
1090489526 11:127146214-127146236 TATGAGTTAGAGAATGAAGATGG + Intergenic
1091696439 12:2631141-2631163 TCTAAGATGGAGAAAGGAAAAGG - Intronic
1092256901 12:6931192-6931214 TCTGTGATGGGGAAGGGAGATGG + Intronic
1092584368 12:9881590-9881612 GAAGAGATGGAGAATGAAGATGG + Exonic
1093853969 12:24076008-24076030 TCTGGGATGGAAAATGAAAATGG + Intergenic
1096582020 12:52591852-52591874 TCTGAGGATGAGAATGTAGAAGG - Intronic
1096949701 12:55454668-55454690 TTTGATAAGGAGAAAGTAGATGG + Intergenic
1097914880 12:65010460-65010482 TTTGATATTGAGAATATAGAGGG - Intergenic
1098958215 12:76709712-76709734 ACTGAGATGGAGAATATCGAGGG - Intergenic
1099936061 12:89127102-89127124 TCTGAAATGTACAATGAAGAAGG + Intergenic
1100258387 12:92907382-92907404 TCTGAGATGGAGAATGTAGATGG - Intronic
1100913544 12:99392079-99392101 GCTGATATGGAGAAAGTAAAGGG - Intronic
1101698477 12:107149450-107149472 GCTGAGATGGAGAAGGGACATGG - Intergenic
1101905574 12:108822783-108822805 TCTGAGATAGACACTGTAGTAGG - Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1103204738 12:119119799-119119821 GATGAGATGGAGAATGGAGGAGG + Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1106815374 13:33401676-33401698 TCTGAGAGAGAAAATGGAGAGGG - Intergenic
1107062518 13:36174979-36175001 TCTGAAATGGAGACTATATAGGG - Intronic
1107437346 13:40391735-40391757 TCTGAGGTGGAGAAAGTAGAGGG - Intergenic
1107591540 13:41912112-41912134 TCTAAGATGGATAATGCAGAAGG - Exonic
1108443656 13:50483555-50483577 TCTGGGATAGAAAATGTACAGGG + Intronic
1108674576 13:52725066-52725088 TCTGAGCTTGTGAATATAGATGG - Intronic
1109778471 13:67075669-67075691 TCTGAAGTGGAGAATGTATTCGG - Intronic
1110227238 13:73132436-73132458 ACTGAGATTGGGAATATAGAAGG - Intergenic
1110972916 13:81788938-81788960 GCTGAGATGGGCAATGGAGAGGG + Intergenic
1111233964 13:85383741-85383763 TCACAGAGGGAGAAGGTAGAGGG - Intergenic
1116663797 14:47748719-47748741 ACTGAGATGGAGGAGGAAGAAGG - Intergenic
1117201871 14:53398620-53398642 CCTGAGATGGGGAGTGCAGAAGG + Intergenic
1118054923 14:62069886-62069908 TCTCAGATGCAGAGTGCAGAGGG - Intronic
1119588575 14:75862573-75862595 TCTGAGAGGGGAAATGTAGGAGG + Intronic
1120406302 14:84097495-84097517 GCTGAGATGGAAATTGTAAATGG - Intergenic
1120478847 14:85023705-85023727 TCTGAGATGAAGATTCCAGAGGG - Intergenic
1120508440 14:85382256-85382278 ACTGAGATGGAGAAAATACAGGG - Intergenic
1120866474 14:89299606-89299628 TCAGAGATGGAGATGATAGAAGG + Intronic
1121212807 14:92221707-92221729 TCTGGGATGGAGCATGAGGAGGG - Intergenic
1122776833 14:104120793-104120815 TCTGAGATGGATAATTTATAAGG + Intergenic
1124174740 15:27413658-27413680 TTTAAGACGGAGAATGCAGAGGG + Intronic
1124554529 15:30712147-30712169 TCTGAAATGCAGAATGTGGCTGG - Intronic
1124588038 15:31027758-31027780 TCTAAGATGAAAAATATAGAGGG - Intronic
1124676720 15:31693530-31693552 TCTGAAATGCAGAATGTGGCTGG + Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125452416 15:39823352-39823374 TCTGAGATGGATAATATTGGAGG - Intronic
1125731220 15:41893734-41893756 TCTGAGAAGAAGAATCTGGAAGG - Intronic
1128364202 15:66985801-66985823 TCTCAGATGGATTAAGTAGAAGG - Intergenic
1131436910 15:92430310-92430332 GCAGAGATGGAAAATGCAGATGG + Intronic
1132658399 16:1050933-1050955 CCTGAGATGGGAAATGCAGACGG + Intergenic
1133241142 16:4415401-4415423 ACTGGGATGGAGAATGGAGGGGG - Intronic
1133395281 16:5442213-5442235 TTTGAGGGGGAGGATGTAGAAGG + Intergenic
1133650401 16:7807278-7807300 TCTAAGATGGAGACTTTTGAAGG + Intergenic
1133856426 16:9553561-9553583 TCGGAGAAGGGGAATCTAGAGGG + Intergenic
1133981859 16:10638936-10638958 TCTAAAATGGAAAAGGTAGACGG - Intronic
1134674430 16:16079440-16079462 GCTGAGATGGACAAAGTGGAGGG + Exonic
1135064679 16:19299514-19299536 TCTGAGATGGTCATTGTAGCTGG - Intronic
1135475406 16:22770266-22770288 CCAGAGATGGACAATGGAGATGG + Intergenic
1136026618 16:27472792-27472814 TCAGAGGAGGAGAATGGAGAGGG - Intronic
1137384702 16:48030604-48030626 TCTGAGATGCCCAATGCAGAGGG - Intergenic
1138213582 16:55183339-55183361 TCTGACATGTAGGGTGTAGAGGG - Intergenic
1139931918 16:70534579-70534601 TCTAAGGTGGAGAATCTAGGAGG + Intronic
1140609172 16:76577715-76577737 TCTGAGCTGGAAAATGTATCAGG + Intronic
1141317317 16:82974817-82974839 TCTGACATGGAGACTCTTGAAGG - Intronic
1142968263 17:3594463-3594485 TCTGAGATTCAGAACGTAGCTGG - Intronic
1144426903 17:15151711-15151733 TCTGAAATGGAGAGGGAAGAGGG - Intergenic
1144837814 17:18166411-18166433 TCAGAGATGGAGCAGGTGGACGG + Exonic
1145270195 17:21400718-21400740 TCTGAGAAGGAGGATGTCAAAGG - Intronic
1145308425 17:21688169-21688191 TCTGAGAAGGAGGATGTCAAAGG - Intergenic
1146774177 17:35597229-35597251 GATGAGCTGGAGGATGTAGATGG + Intronic
1149003018 17:51776299-51776321 TGGGAGATGGAGATTGTAGTGGG + Intronic
1149393332 17:56214313-56214335 TCTGAGATGGTGAAGCTTGAGGG + Intronic
1151422997 17:74010833-74010855 TCTGATATCCAGAATCTAGAAGG + Intergenic
1153980129 18:10301707-10301729 TCAGAGAGGGAGAATGGTGAAGG - Intergenic
1155042010 18:22072702-22072724 TCTGACATGGAGGATGTCTATGG + Intergenic
1155313452 18:24547525-24547547 TCTGGGATGGAGGAAGTATAAGG + Intergenic
1156290867 18:35747812-35747834 TTTGAGGTGGAGAATGAAGCAGG + Intergenic
1156362973 18:36400573-36400595 TCTGAGAAGGAGACTGTGGTTGG + Intronic
1157398782 18:47368277-47368299 GCAGAGATGGAGGAGGTAGAAGG + Intergenic
1157575040 18:48738062-48738084 TCTGAGATGGGGAAGACAGAGGG - Intronic
1160420632 18:78741618-78741640 AGTGCGATGGAGAAGGTAGAGGG + Intergenic
1161098801 19:2409977-2409999 CCTGAGATGGGGAATGCTGAGGG + Intronic
1161180050 19:2874306-2874328 TCTAAGATTTAGAATGCAGAAGG + Intronic
1161618759 19:5287273-5287295 TCCGGGATGTAGAATGTAGGGGG - Intronic
1162153807 19:8663467-8663489 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162153825 19:8663525-8663547 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162702627 19:12529162-12529184 TATGAGAAAGTGAATGTAGACGG - Intronic
1164737445 19:30552305-30552327 TCTCAGATGGATAAAGTTGAGGG + Intronic
1164896940 19:31885189-31885211 TCCAAGAAGGAGAATTTAGAAGG + Intergenic
1165982684 19:39738008-39738030 TCTGAGCTGCAGAATTTAAATGG + Exonic
1166534935 19:43567223-43567245 TCTGAATTAGAGAATGGAGATGG + Intronic
1167654303 19:50753499-50753521 TCAGAGATGAATAATGCAGATGG + Intergenic
1168574608 19:57499717-57499739 TCGGAGATGGAGATTGGAGACGG - Intronic
1202646227 1_KI270706v1_random:144550-144572 TCTGAGATGGGAGATGCAGAAGG - Intergenic
925458414 2:4039303-4039325 TCGAAGAAGGAGAATGTAAAGGG + Intergenic
925651639 2:6096396-6096418 AATGAGATGGAGAAACTAGACGG + Intergenic
926039434 2:9660945-9660967 TCTCAGATGGAGAAATTAGAAGG - Intergenic
926418354 2:12673161-12673183 GCTGAGATGGAAAATCTGGAAGG - Intergenic
926446330 2:12947140-12947162 TCTCACATGGAGACTGTAAATGG + Intergenic
929570775 2:43021733-43021755 GCTGAGATGGAAAATCTGGAAGG + Intergenic
929980499 2:46674797-46674819 TCTGAGATGATTAATGCAGATGG - Intergenic
930566646 2:53028882-53028904 TGTGAGATGGAGCCTGTGGAGGG + Intergenic
931838151 2:66121436-66121458 TGTGGGATGGAGAGTGTAGATGG - Intergenic
931853184 2:66274584-66274606 ACTGAGATGGGAAATATAGAAGG - Intergenic
933595674 2:84280751-84280773 TCGGAGATGGAGAATGGATTGGG + Intergenic
934125171 2:88881425-88881447 TCTGAGATGGGGAAGGCAGGCGG - Intergenic
934968170 2:98741203-98741225 TCTGAGTTGAAGAAAGTAGTAGG + Intergenic
935088377 2:99870278-99870300 TCTGAGATTGAGGCTGTAGTTGG + Intronic
935470404 2:103452743-103452765 TCTGAGATGTAGAAACAAGATGG + Intergenic
937650860 2:124317517-124317539 TTTGAGAAAGATAATGTAGATGG - Intronic
938194192 2:129312164-129312186 TCTAAAATGTAGAAAGTAGAAGG + Intergenic
940112294 2:150168210-150168232 TCTAAGATGGGGCCTGTAGATGG + Intergenic
940971007 2:159896777-159896799 TCTGACATGTAGAACTTAGATGG + Intronic
941017226 2:160371296-160371318 TTTGAGAGGCAAAATGTAGAAGG - Intronic
942569743 2:177301990-177302012 TCTGAGATGGAGACTGAGTAGGG - Intronic
943834747 2:192505084-192505106 TCTTGGATGGAGTATGTTGAAGG - Intergenic
943937435 2:193938513-193938535 ACTGAGATGGAAAATTTAAAAGG - Intergenic
946139085 2:217672871-217672893 TCTTAGCTGGAGAATATAGAGGG - Intronic
946182695 2:217958477-217958499 GCTGGGATGGAGAATGACGATGG + Intronic
946311493 2:218884551-218884573 TCTGAGAAGTAGAAGGTAGAAGG - Intronic
946530270 2:220563263-220563285 TCAGAGAGGCAGAAAGTAGACGG + Intergenic
948001650 2:234572686-234572708 TCTGAGATAAAGAATCTGGATGG + Intergenic
948917543 2:241043071-241043093 TCTGCGAAGGAGGATGGAGATGG + Intronic
1169071335 20:2733514-2733536 TCTGAGAAGGAGAGTAGAGATGG - Intronic
1170058151 20:12229830-12229852 TCTGAGATTGAGGATGAGGAGGG - Intergenic
1170631347 20:18068928-18068950 TCATAGAAGGAGAAAGTAGAAGG - Intergenic
1171152048 20:22835853-22835875 TCTGAAATGGAGAATGCACGTGG + Intergenic
1172080167 20:32334193-32334215 TCTGATCTGGAGAATGTATCTGG + Exonic
1172449581 20:35012525-35012547 CCTTCGATGGAGAATGTACAAGG - Intronic
1172789212 20:37490960-37490982 TGGGAGGTGGAGAGTGTAGAGGG - Intergenic
1175201831 20:57283376-57283398 TCTGAGATGGAAAAGGGGGAGGG + Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1177895135 21:26847676-26847698 TTTGAGATGGAGATTTGAGATGG + Intergenic
1178207191 21:30482497-30482519 TCTGAAATGGAGAATAAAAATGG - Intronic
1179986529 21:44924840-44924862 TCTGAAAAGCAAAATGTAGAAGG + Intronic
1182390970 22:29995740-29995762 TCTGAGATGGAGATTTTTAAGGG + Intronic
1182404663 22:30115784-30115806 GCTGAAGTGGAGAATGAAGAAGG + Intronic
1182481617 22:30612932-30612954 TCTGAGAGCGAGCAGGTAGAGGG - Exonic
1183009854 22:34935915-34935937 TTTGAGATGGAGAAAACAGAGGG - Intergenic
949217613 3:1588538-1588560 TCTAACATGGAGAATTTATAAGG + Intergenic
949730603 3:7108199-7108221 TCTGAAATATATAATGTAGAAGG - Intronic
950112373 3:10427650-10427672 TCTGGGATGGTGAAGGTGGAGGG + Intronic
950203810 3:11062762-11062784 AATGAGATGGAGAAGGCAGAGGG + Intergenic
950409852 3:12828705-12828727 TCTGAGATGGACAGTGGTGACGG - Intronic
952505325 3:34002059-34002081 TCCAAGATGGAGAATGGAGTTGG - Intergenic
954770652 3:52965149-52965171 TTTGAGCTGGAGAAGGAAGAGGG - Intronic
954859809 3:53677950-53677972 AGTGAGCTGAAGAATGTAGAGGG + Intronic
955547399 3:60045808-60045830 ACTGAAATGGAGAATGGATAAGG + Intronic
960079468 3:113525878-113525900 TGTGAGATGGAGAGTGCAGCTGG + Intergenic
960270193 3:115665513-115665535 TCTGAGAATGATAATGAAGAAGG - Intronic
960500359 3:118430462-118430484 TCTGATATCCAGAATGTATAAGG - Intergenic
960500440 3:118431246-118431268 TCTGATATCCAGAATGTATAAGG - Intergenic
960851136 3:122055877-122055899 AATGAGATAGAGAAGGTAGAGGG + Intronic
960965020 3:123098615-123098637 TCTTCCATGGAGAATGTGGAAGG - Intronic
961088578 3:124090872-124090894 TCTGAGATAGAGAATGTGTGAGG + Intronic
961248056 3:125474057-125474079 TTTGTGATAGAGAATGTAGGTGG - Intronic
961541454 3:127602825-127602847 TCAGAGATGGGGAAAGTACAGGG + Intronic
961630400 3:128294364-128294386 TCTGGGAAGGGGAATTTAGAGGG + Intronic
961928858 3:130512273-130512295 ACTGAGATAGTGAATATAGAAGG - Intergenic
962187383 3:133274176-133274198 TCTGAGATGGATCTTGTAGATGG - Intronic
962399594 3:135047005-135047027 ACTGAGTTGGAGAGAGTAGAGGG + Intronic
966985884 3:185179960-185179982 GCTGAGAAGGAGGATGGAGAAGG + Intergenic
966986624 3:185186235-185186257 TCTGAGATGCAGCCTGTTGAGGG + Intergenic
967059626 3:185860678-185860700 TCTGATATGCAGAATCTATAAGG + Intergenic
967360871 3:188630234-188630256 TCTGATATTGAGAATCTATATGG + Intronic
967676715 3:192307858-192307880 TCTCAGATGAAAAATGCAGAGGG - Intronic
968249511 3:197194459-197194481 TCAGAGATTGAGAATGTCCATGG - Exonic
969531174 4:7731788-7731810 TCTGAGCTGGATTTTGTAGAGGG - Intronic
971007827 4:22394981-22395003 TGTGAGATGGAGAATACAGTAGG - Intronic
971454954 4:26835487-26835509 GCTGAGATCGAAAATGTAGAAGG - Intergenic
972213907 4:36873230-36873252 TCTGAGAGTGAGAATGGAGTTGG - Intergenic
972968628 4:44544607-44544629 TCTGAGGGGGAGAAAATAGACGG + Intergenic
973388539 4:49532363-49532385 TCTGAGATGGGAGATGCAGAAGG + Intergenic
973754589 4:54062689-54062711 TTTGACATGAGGAATGTAGAAGG + Intronic
973932482 4:55806994-55807016 TATGAGATAAAGAAGGTAGAGGG + Intergenic
974193564 4:58539728-58539750 TCTGGGATGGATAATTTAAAGGG + Intergenic
974759955 4:66262344-66262366 TATCAGATGGATAATGTAAATGG - Intergenic
975172433 4:71247509-71247531 TCAGAGATGGACAATGTGGTTGG + Intronic
975931394 4:79527922-79527944 TCTGAGATTTAGACTGTGGAAGG - Intergenic
976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG + Intergenic
976784510 4:88802763-88802785 TCTGGGATAGAGGATGCAGACGG - Intronic
977338968 4:95733562-95733584 GATGAGATGGAGGAGGTAGAAGG + Intergenic
977811522 4:101361129-101361151 TGGGAGATGGATAATCTAGATGG + Intergenic
978149576 4:105416809-105416831 TATGAAAAGGAGAATGGAGAAGG - Intronic
978468815 4:109038947-109038969 ACTGAGATGGAGAATAAAGATGG - Intronic
979557124 4:122061856-122061878 GCTGAGAAGGAGAAAGAAGAGGG - Intergenic
980772591 4:137396187-137396209 TCAGAAATGGAGAAAGTAGAAGG - Intergenic
980984606 4:139683384-139683406 TCTGAGATGGAGAAGGCTGCAGG + Intronic
981532495 4:145765681-145765703 GCTGAGAGGGAGGATGAAGAGGG + Exonic
982582715 4:157199251-157199273 TTTGAGATGAAGAATAGAGATGG - Intergenic
983865822 4:172765209-172765231 TATTACATGGAGAATGCAGAAGG + Intronic
986517882 5:8582274-8582296 TCAGAGATGGTAACTGTAGAGGG - Intergenic
987537118 5:19203881-19203903 GCTGTCATGGAGAATGTAGCAGG + Intergenic
987938157 5:24496409-24496431 TCTGAGATGGAAAAGGTGAAGGG + Intronic
988090254 5:26530018-26530040 ACTGAGATGGGGAATCTAGAAGG + Intergenic
989014272 5:36911149-36911171 TCTCATATGGAGGATGTAGTAGG + Intronic
990558479 5:56960636-56960658 TCGGAGATGGAGGAGGGAGAAGG - Intronic
992748311 5:79839943-79839965 TCTGAAATGGCGAATGAATAGGG - Intergenic
992866827 5:80965235-80965257 TGGGAGATGGAGAGTGTGGATGG + Intronic
993163931 5:84326807-84326829 TCTCAAAGAGAGAATGTAGAAGG - Intronic
993500600 5:88661643-88661665 TCTAAGATGGTGAATGGAAATGG - Intergenic
993574012 5:89579169-89579191 TCTGTAAAGGAGAATTTAGAGGG + Intergenic
994117280 5:96074704-96074726 TCTGAGATGGGGAAGAAAGAAGG + Intergenic
994207905 5:97056537-97056559 CCTGATATGGATAATGAAGAAGG - Intergenic
996697202 5:126410989-126411011 TCTAATATGCAGAATCTAGAAGG - Intronic
997112801 5:131093513-131093535 TCAGAGACAGAGAAAGTAGAAGG - Intergenic
997671044 5:135672220-135672242 GAAGAGATGGAGAATGTAAAGGG + Intergenic
999268715 5:150283901-150283923 TCTGTGCTGGAGAAGGTTGAGGG - Intronic
999384187 5:151142736-151142758 TCTGAGATGGAGGACGCCGAAGG + Intronic
999577914 5:153000783-153000805 GCTGAAATGTAGAATGGAGAAGG - Intergenic
1000038185 5:157464690-157464712 CTTGAGATGAAGAGTGTAGAAGG + Intronic
1000576951 5:162986754-162986776 TATGAGATGGACACTGTAGATGG - Intergenic
1000733161 5:164861610-164861632 TCTGAGATGGACAAAAGAGAAGG - Intergenic
1000778238 5:165445555-165445577 TCTCACATGGAAAATGAAGATGG - Intergenic
1001118798 5:168961941-168961963 TATGATATGGAGAATGGACAGGG + Intronic
1002380578 5:178825351-178825373 GATGAGATGGAGGATGAAGAAGG - Intergenic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1003155062 6:3586374-3586396 TCTGAGGTAGAGAATGTCAAAGG - Intergenic
1004507394 6:16258159-16258181 TCAGAGATGGAGAAGAAAGATGG + Intronic
1004962323 6:20803869-20803891 TATGGGATCGAGAATGTAGGTGG + Intronic
1005117873 6:22357605-22357627 TCAGAGATGGAGCAACTAGAGGG + Intergenic
1005155650 6:22803074-22803096 TTTTAGATGGAGATTTTAGATGG - Intergenic
1005844505 6:29766913-29766935 TGTGAGATTGAGAGTGTGGAAGG - Intergenic
1005921155 6:30403037-30403059 TGTGAGTTGGAGGATGTAAAAGG - Intergenic
1005964894 6:30720337-30720359 TCTGAGAGGGAGAAAGGAGAGGG - Exonic
1006980794 6:38146202-38146224 TCTCAGATGGAGGGTGTAGCTGG + Intronic
1008124923 6:47657241-47657263 TCTGAGAAGAAGAATGTGTAAGG - Intronic
1008205327 6:48649126-48649148 TCTGAGATCCAGAATCTACAAGG + Intergenic
1008950074 6:57147766-57147788 TATGAGATGGATGAGGTAGAAGG + Exonic
1009617855 6:66033692-66033714 TCAGAGAGAGAGAGTGTAGAAGG - Intergenic
1010010075 6:71038903-71038925 TCTTAGAGGGAGGATGGAGAGGG + Intergenic
1010194994 6:73230311-73230333 TGGGAGATGGAGGCTGTAGAGGG - Intronic
1010490061 6:76465191-76465213 CCTTAGATGGAGAATGTAGGAGG - Intergenic
1011666702 6:89641532-89641554 TCCCAGATGGGGAATGTTGAAGG + Intergenic
1012032780 6:94093800-94093822 TAGGAGATGGAGGATGTGGAAGG - Intergenic
1012628711 6:101435746-101435768 TGTCAGATGGAGAATGTCAATGG - Intronic
1012676684 6:102122541-102122563 ACTGAGAGTGAGGATGTAGAAGG - Intergenic
1012957399 6:105586185-105586207 TCAGAGCAGGAGAATGAAGAGGG + Intergenic
1013031967 6:106342616-106342638 TCTGTGATAGAAAATGTAGGGGG + Intergenic
1013460592 6:110371524-110371546 TCTGAGATGGAAAACATTGAGGG - Intergenic
1014899953 6:126951127-126951149 ACTGAGAAGGAGATTATAGAAGG - Intergenic
1015718053 6:136212125-136212147 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718055 6:136212152-136212174 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718057 6:136212179-136212201 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718059 6:136212206-136212228 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718061 6:136212233-136212255 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718063 6:136212260-136212282 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015825758 6:137309800-137309822 TTTCAGATGGGGAATGGAGAGGG - Intergenic
1016667425 6:146658101-146658123 CCTGGGATGGGGAATGTTGAAGG + Intronic
1017321391 6:153098083-153098105 TCTTAGATCGAGAAAGTAAAAGG + Intronic
1017809063 6:157971018-157971040 GCTGAGATGAAGGAGGTAGAGGG + Intergenic
1018455365 6:163946998-163947020 TCTGAACTGGATAATGTACAGGG - Intergenic
1018959298 6:168435730-168435752 TCTGAGATGGAGAATATTGGAGG + Intergenic
1019010357 6:168839769-168839791 TCTGAGATGGGGAGTGGAGAGGG + Intergenic
1019010370 6:168839815-168839837 TCTGAGATGGGGAGTGGAGAGGG + Intergenic
1019460367 7:1155184-1155206 CCTGAGATGGAGAATTCACATGG - Intronic
1020364626 7:7367838-7367860 ACTGAGATGGAGAATATAAAAGG - Intronic
1021044341 7:15903679-15903701 TCTGAGATGGAGTCTGAAAATGG + Intergenic
1021387586 7:20050798-20050820 GCTGAGAGGCAGACTGTAGAAGG - Intergenic
1022630259 7:32077991-32078013 TCTGAGAGGCAGAATGTCCACGG - Intronic
1023097957 7:36681958-36681980 TCTGTGAGGGAGAAAGTAGAGGG + Intronic
1023215323 7:37856275-37856297 TTGGAGATGGAGACTTTAGAAGG + Intronic
1024274575 7:47667477-47667499 TCTGAGTTTGACAATGGAGAAGG - Intergenic
1024332196 7:48166956-48166978 TCTAATATGGAGAATCTATAAGG + Intergenic
1024343487 7:48290245-48290267 GCTGAGTTGGAGAATGCAGCTGG + Intronic
1024871283 7:53964188-53964210 TCTCAGCTGGAGAACCTAGAAGG - Intergenic
1024928700 7:54646394-54646416 ACTGAGATGGAGAATATAGGAGG + Intergenic
1026098662 7:67367009-67367031 TTAGAGATGCAGAAGGTAGAAGG + Intergenic
1026526548 7:71158358-71158380 TCTCAGATGGAGAAAGATGAAGG - Intronic
1028968143 7:96826156-96826178 AGTGAGATGGGGAATGAAGAGGG + Intergenic
1030031762 7:105376340-105376362 TCTGAGATGAAGAATGCCGTAGG - Intronic
1030398976 7:109024991-109025013 GCTAAGATAGAGAATGTTGAGGG + Intergenic
1031626626 7:123999753-123999775 TCTGATATGCAGAATCTATAAGG + Intergenic
1032482499 7:132257991-132258013 TCTGAGATGGAGGGTGTAGCTGG + Intronic
1033034529 7:137861428-137861450 CCTGAGCTAGAGAATGGAGATGG + Intergenic
1035037593 7:155905477-155905499 TATGAGGTGCAGAATGTAGGCGG - Intergenic
1035120501 7:156562891-156562913 TGTGTGATGGAGAATGGAGATGG + Intergenic
1037583615 8:20261553-20261575 TTTGGGAGGGAGAATGCAGAAGG - Intronic
1038136359 8:24790558-24790580 TCGGAGCTGGAGAATGGGGAGGG - Intergenic
1039306262 8:36266675-36266697 GCTGATATGGAGGCTGTAGAAGG - Intergenic
1039404010 8:37297389-37297411 TCTGGGATGGGCAATGAAGAAGG + Intergenic
1039651939 8:39351424-39351446 TCAGGGAATGAGAATGTAGATGG - Intergenic
1039770030 8:40676441-40676463 TCTGAGATGTAGGATGCAGCTGG + Intronic
1040554998 8:48470311-48470333 TCTGAAGTGGAGAATCTAAATGG - Intergenic
1041137783 8:54778789-54778811 TGTGAGAGGGAGGCTGTAGAGGG + Intergenic
1041733615 8:61087468-61087490 TCTGAGTTGGAGCATGAGGAGGG - Intronic
1043364579 8:79517798-79517820 GCTGAGAAGGAGAAGGCAGAGGG + Intergenic
1043482222 8:80664927-80664949 TCTGGGATGGGGAAAGTAGGAGG + Exonic
1044288659 8:90441163-90441185 TCTGAGATGTAGAAGGAAAAAGG - Intergenic
1044933449 8:97271677-97271699 TCTGATATGTGGAATGCAGAAGG - Intergenic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1047031747 8:120889446-120889468 ACTGAGCTGGAGAATTTACAAGG + Intergenic
1048879929 8:138863741-138863763 TCTGAAGTGGACAATGTAGGAGG + Intronic
1049052026 8:140205766-140205788 GCTGAGATGGAGACTGTAGGAGG - Intronic
1049292523 8:141812216-141812238 GCTAAGATGAAGAATGGAGAAGG - Intergenic
1049336897 8:142091442-142091464 TCTGGGATGGAGACGGGAGATGG + Intergenic
1050936249 9:11399326-11399348 TCTGGGAGGGAAAATGGAGATGG - Intergenic
1051572698 9:18578366-18578388 TCTGAGATGCAGGGTGAAGAGGG - Intronic
1053372857 9:37576941-37576963 TCTGTAGTGGAGAAGGTAGACGG + Intronic
1054528546 9:66157007-66157029 TCTGAGATGGGAGATGCAGAAGG - Intergenic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1057717306 9:97504669-97504691 TCTGCGATGGAGGATGGTGATGG + Intronic
1058665030 9:107305445-107305467 GCAGAGATGGAGGAGGTAGAAGG + Intronic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1058973653 9:110106206-110106228 TCTGAGATGGAGACTCAAGTGGG + Intronic
1059420448 9:114187211-114187233 TCAGAGATGGAGTATGCAGGGGG + Intronic
1186194680 X:7098774-7098796 TCTGAGAGGGGGAAAGTAGAGGG + Intronic
1188021452 X:25163101-25163123 TCTGAGTAGGAGGATGCAGAAGG - Intergenic
1188522533 X:31054642-31054664 TTTGAGATGGAGAAGGTATGGGG + Intergenic
1188535278 X:31190229-31190251 TCTGAAGAGGAGACTGTAGAGGG + Intronic
1188790315 X:34401480-34401502 TCTGAGATCTAGAATCTATAGGG + Intergenic
1189035948 X:37493483-37493505 TCTGCTCTGAAGAATGTAGAGGG + Intronic
1189874593 X:45422524-45422546 TCTGATATCCAGAATGTATAAGG + Intergenic
1190458413 X:50646770-50646792 TCTGAGGTGGAGGGTGGAGAGGG - Intronic
1190574880 X:51825218-51825240 CCAGAGAGGGAGATTGTAGAGGG + Intronic
1191608231 X:63084223-63084245 TTTGAGTGGGAGAATGAAGAAGG + Intergenic
1193423977 X:81318328-81318350 TCTGAGATGGAGAGTTTGCAGGG + Intergenic
1193868763 X:86770419-86770441 TCTGACATGGAGAAACCAGAGGG - Intronic
1194737196 X:97526599-97526621 TTAGAGATGGAGAAGGTAGAAGG - Intronic
1194883892 X:99288728-99288750 TCTGAGATAGAGACTGCAGGAGG + Intergenic
1196046054 X:111257706-111257728 GCTGAGATGCAGAGTGCAGATGG + Intronic
1196132442 X:112171972-112171994 TCTGATATCCAGAGTGTAGAAGG + Intergenic
1198084704 X:133271018-133271040 TAAGAGATGGAAAATGTTGATGG + Intergenic
1199491783 X:148407949-148407971 TATCAAAGGGAGAATGTAGATGG - Intergenic
1201336854 Y:12890946-12890968 TCTGTGATGGAAAATGTACTGGG - Intergenic