ID: 1100259188

View in Genome Browser
Species Human (GRCh38)
Location 12:92915861-92915883
Sequence GTATATGCTTAGTTTTCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100259184_1100259188 25 Left 1100259184 12:92915813-92915835 CCATAAATTGGCTGACCTAAAAG 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1100259188 12:92915861-92915883 GTATATGCTTAGTTTTCTTATGG 0: 1
1: 0
2: 2
3: 13
4: 281
1100259186_1100259188 10 Left 1100259186 12:92915828-92915850 CCTAAAAGGATGTCAAACATATT 0: 1
1: 0
2: 1
3: 24
4: 368
Right 1100259188 12:92915861-92915883 GTATATGCTTAGTTTTCTTATGG 0: 1
1: 0
2: 2
3: 13
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100259188 Original CRISPR GTATATGCTTAGTTTTCTTA TGG Intronic
900928705 1:5722139-5722161 GTATTGGCCTGGTTTTCTTATGG - Intergenic
904058957 1:27691768-27691790 GTATAAGGCTAGTTTTCTCAAGG + Intergenic
906153633 1:43601777-43601799 GTAGCTGCTTTGTGTTCTTAGGG + Intronic
906799475 1:48723570-48723592 TTCTGTGTTTAGTTTTCTTATGG - Intronic
907141560 1:52190380-52190402 GTTTATGCTTAGTGTACTTTGGG + Intronic
907584379 1:55603771-55603793 GTATCTGCTAAGTGTTCTAAAGG + Intergenic
908065396 1:60398136-60398158 GTAGATGCTTAGTAGTCTAAAGG - Intergenic
909120300 1:71595027-71595049 CTATATGCTTATGTTCCTTATGG + Intronic
909854310 1:80508554-80508576 GTATATGGTTAGTATCATTAGGG + Intergenic
909869057 1:80715803-80715825 CCAAATGCTTAGCTTTCTTAAGG - Intergenic
910709355 1:90163432-90163454 TTATATTCTCAGTTTACTTATGG - Intergenic
911108044 1:94152740-94152762 GTATATTCTTAAATTTCTGAGGG + Intronic
912392907 1:109317136-109317158 AGAGATGCTTAGTTTGCTTAAGG - Intronic
914870458 1:151469646-151469668 TTATATTCTTAATTTTCTTGTGG + Intergenic
915576327 1:156780620-156780642 TTATATTTTTAGTTTTTTTAAGG + Intronic
916143128 1:161716911-161716933 GCATATGCTAAGTTTTCTCTTGG - Intergenic
917607990 1:176655244-176655266 GTCTATGCCTAGTTTGCTCATGG + Intronic
921201765 1:212813309-212813331 GTATATGCTTTATTTGCTTTAGG + Intronic
921326616 1:213990459-213990481 GTGTTTGTTTATTTTTCTTAAGG + Intronic
922052001 1:222000185-222000207 TTCTATTCTTAGTTTTCTAAAGG + Intergenic
922400413 1:225248580-225248602 GTATATACTCTGTTTTCTTTTGG - Intronic
1064700947 10:18021063-18021085 GTATTTGCTAGGTTTTCTTCTGG + Intronic
1066983506 10:42441746-42441768 GTTTTTGCTTAGTTTTGTTTTGG - Intergenic
1067255121 10:44630337-44630359 GTATTTTCTTACTTTTCTTGTGG - Intergenic
1067350449 10:45471068-45471090 GTATATACTTACTTTTTTAATGG - Intronic
1067371586 10:45688741-45688763 GTTTTTGCTTAGTTTTGTTTTGG + Intergenic
1067388197 10:45837407-45837429 GTTTTTGCTTAGTTTTGTTTTGG - Intronic
1067417928 10:46119874-46119896 GTTTTTGCTTAGTTTTGTTTTGG + Intergenic
1067446069 10:46347195-46347217 GTTTTTGCTTAGTTTTGTTTTGG + Intergenic
1067503284 10:46826436-46826458 GTTTTTGCTTAGTTTTGTTTTGG + Intergenic
1067591310 10:47513575-47513597 GTTTTTGCTTAGTTTTGTTTTGG - Intronic
1067638428 10:48021668-48021690 GTTTTTGCTTAGTTTTGTTTTGG - Intergenic
1069260883 10:66395023-66395045 GTATATACTTATTATTCTGAGGG - Intronic
1070135031 10:73686094-73686116 GTTTTTGCTTAGTTTTGTTTTGG - Intronic
1070613072 10:77947721-77947743 GTCTATGCTTAATTTTCTGAGGG + Intergenic
1074898876 10:117800048-117800070 ATATATGCTGAGTTTGCTTGGGG - Intergenic
1081076860 11:38686565-38686587 GTATATTGTTAGTGTGCTTAAGG - Intergenic
1085168044 11:74421991-74422013 ATATATGCTAAGCTTTCTTTGGG + Intergenic
1085375198 11:76054019-76054041 GTATAGGTTTGGTTTTCTTGTGG + Intronic
1086076140 11:82855078-82855100 GTATTTCCTCAGTTTTCTTCTGG - Intronic
1086793864 11:91075559-91075581 ATATATGTTTCCTTTTCTTAAGG + Intergenic
1086813545 11:91340383-91340405 TTCTATGCCTAGTTTTTTTAGGG - Intergenic
1087404550 11:97714239-97714261 GTATATTCTGAGTTTTCTATAGG - Intergenic
1087418358 11:97887775-97887797 GTATTTGCTTTCTTATCTTAGGG - Intergenic
1087502776 11:98979574-98979596 GTCTGTGCTTATTTTTATTAGGG - Intergenic
1087689748 11:101306429-101306451 GTACATGCATACTTTTCTGATGG - Intergenic
1087772864 11:102229323-102229345 GTTTATGTTTAGTCTTATTATGG + Intronic
1087843982 11:102950448-102950470 GTATAAACTTAGGTTTCTTGAGG + Intronic
1087950508 11:104214893-104214915 GCATATACCCAGTTTTCTTAGGG + Intergenic
1088005896 11:104939854-104939876 GTAGATGGTTATTTTTCTTCAGG + Intergenic
1091254982 11:134175484-134175506 GTTTCTGCTCAGTTTTCTTTAGG - Intronic
1091570453 12:1680741-1680763 GTATATAGTTATTTTTCTGAGGG + Intergenic
1092995684 12:13948254-13948276 GTAAATGCTTTCTTTTCATAAGG + Intronic
1094370719 12:29735013-29735035 GCATATGCTTAGTTGTTTAATGG - Intronic
1095085599 12:38055189-38055211 GTATATGCTTGGGTTCCATAGGG - Intergenic
1096734873 12:53644842-53644864 GTATATGCATAGACTTCTTTGGG + Intronic
1097775873 12:63645165-63645187 GTATAAACATACTTTTCTTATGG + Intronic
1100259188 12:92915861-92915883 GTATATGCTTAGTTTTCTTATGG + Intronic
1105321927 13:19333760-19333782 CTATCTTCTTAGTTTTCTTCAGG - Intergenic
1105876817 13:24562098-24562120 CTATCTTCTTAGTTTTCTTCAGG + Intergenic
1107503498 13:41006070-41006092 GTATATGTTAAGTTCTCTTTAGG - Intronic
1108087770 13:46812783-46812805 GTATATGCTTTTTATTCCTATGG + Intergenic
1108488999 13:50960493-50960515 TTTTATACTTAGTTTCCTTAAGG + Intronic
1108900942 13:55407606-55407628 AAATATACTTAGTTTTTTTATGG + Intergenic
1108907667 13:55499286-55499308 ATATATGCATAGTGTTTTTAGGG - Intergenic
1108966434 13:56310015-56310037 ATATATGCTTACTTATTTTAGGG + Intergenic
1109350346 13:61171826-61171848 GTATACTTTTATTTTTCTTAAGG - Intergenic
1109743956 13:66595456-66595478 GTATATGCTTGGTTATATAAAGG + Intronic
1110207415 13:72932334-72932356 GTTTATTATTTGTTTTCTTAAGG + Intronic
1110394819 13:75017149-75017171 TTATATGTTTGGTTCTCTTAGGG - Intergenic
1110667728 13:78137616-78137638 CTATATGCTTGGTTTTCTGGAGG + Intergenic
1111163748 13:84429948-84429970 GTATTTGGTTGGTTTTCTAAGGG - Intergenic
1111825954 13:93268065-93268087 ATATTTGCATAGTTTTCTCAGGG + Intronic
1114351611 14:21858550-21858572 CTATATGCTCAGCTTTCTTGGGG + Intergenic
1114356156 14:21911223-21911245 CTATATGCTCAGCTTTCTTGAGG + Intergenic
1116103235 14:40467332-40467354 CTATATGCTTATTTTCCTTTAGG - Intergenic
1116503144 14:45645472-45645494 GCATTTGCTTATTTTTCTTTTGG + Intergenic
1117226784 14:53669316-53669338 GTATGTGCTTATTTTCCTTTTGG - Intergenic
1117552153 14:56847318-56847340 AGATATGCAAAGTTTTCTTAGGG + Intergenic
1119624728 14:76162842-76162864 GTTTATAATTAGTTTTCTTAGGG + Intronic
1120387150 14:83861006-83861028 GTATGTGCCTAGGTTTCATATGG - Intergenic
1120388794 14:83879826-83879848 GTCTATGCTTTGTTTTCTATAGG + Intergenic
1120990869 14:90375802-90375824 GCATTTGCTAAGTTTTATTATGG - Intergenic
1124224165 15:27875748-27875770 GTTTATTCCTAGGTTTCTTAGGG + Intronic
1125408337 15:39377935-39377957 GTTTTCGCTTATTTTTCTTATGG - Intergenic
1127811391 15:62568357-62568379 GTCTATGCTTCATTTTCTTCAGG + Intronic
1132086321 15:98911194-98911216 GTATATGCTAAGTTCCCTTCTGG - Intronic
1132217408 15:100075700-100075722 CTATTTGCTTGGTTTTCTTTTGG + Intronic
1134376787 16:13683694-13683716 ACATATGCTTAGTTTTCATGTGG + Intergenic
1136931543 16:34422234-34422256 GAATATCCTTATTTTTTTTAAGG - Intergenic
1136973029 16:34989585-34989607 GAATATCCTTATTTTTTTTAAGG + Intergenic
1136984677 16:35089082-35089104 GTATCTGCTTACTTTTCTACTGG - Intergenic
1138196231 16:55054294-55054316 TTCTATGCTTAGTCTTCTTGGGG + Intergenic
1138930132 16:61644140-61644162 CAAAATGCTTAGTTTTCTGAGGG + Intergenic
1140736447 16:77902131-77902153 GTGTATGCTTTGTTTTCTAATGG - Intronic
1147497886 17:40935458-40935480 GTATTTGCTTAGCTTTTTTGAGG + Intronic
1147655354 17:42087123-42087145 GTATATGCTTAATAGTATTAAGG - Intergenic
1149060606 17:52416994-52417016 GTTTATGATTAGTTTTCTGAAGG + Intergenic
1150637707 17:66927239-66927261 GTCTTTGCTTAGTTTTCTACTGG - Intergenic
1150895103 17:69200647-69200669 ATATATGCTTAATTATCTTATGG + Intronic
1150955195 17:69850654-69850676 TTCTATGTTTAGTTTTTTTAAGG + Intergenic
1154437602 18:14359067-14359089 ATATTTTCTAAGTTTTCTTACGG + Intergenic
1155528888 18:26745572-26745594 GTATCTTCTCCGTTTTCTTATGG + Intergenic
1155927890 18:31677517-31677539 GTAAATGCTTAATTTTCCAAAGG + Intronic
1156067214 18:33158284-33158306 GTATTTTCATAGCTTTCTTAGGG - Intronic
1157703594 18:49781614-49781636 TTCTATTCTTAGTTTTCTTAAGG - Intergenic
1158337616 18:56430746-56430768 GTATTTCCTTAGTTATCTTCTGG - Intergenic
1159104734 18:63993121-63993143 GTATTTTTTTAGTTTTTTTAAGG + Intronic
1159733727 18:72065853-72065875 GTATTTGCTTTATTATCTTAAGG - Intergenic
1167126646 19:47553909-47553931 GTACATGTTGAGTTTTCTTTTGG - Intronic
927913649 2:26919350-26919372 AAATATACTGAGTTTTCTTAGGG + Intronic
929052989 2:37853760-37853782 TCATATGCTTAGTTTTCTACAGG - Intergenic
929987482 2:46749552-46749574 GGTTATGCTTCATTTTCTTATGG - Intronic
930296114 2:49556390-49556412 GTCTATGCCTTGTTTTCTTTGGG + Intergenic
931270368 2:60696638-60696660 GTATGTGATGTGTTTTCTTATGG + Intergenic
931378035 2:61725380-61725402 ATATGTGCCTAGTTTTCTTTGGG + Intergenic
931430929 2:62208563-62208585 GTAGATGCTTAGGATACTTATGG + Intronic
931753875 2:65354698-65354720 GTATATATTTAGTATTCTTGTGG - Intronic
933234715 2:79852294-79852316 GTATTTTTTTAGTTCTCTTAAGG + Intronic
933915106 2:86982741-86982763 ATATATGTTTACTTTTATTAAGG - Intronic
934007888 2:87787159-87787181 ATATATGTTTACTTTTATTAAGG + Intronic
935041533 2:99433695-99433717 GTAACTGATTAGTTTTCTCATGG - Intronic
935744784 2:106181026-106181048 GAATCTCCTTAGTTTTCTGATGG + Intronic
935771527 2:106428077-106428099 ATATATGTTTACTTTTATTAAGG + Intronic
935908546 2:107867870-107867892 ATATATGTTTACTTTTATTAAGG - Intronic
935994944 2:108760088-108760110 ATATATGTTTACTTTTATTAAGG - Intronic
936130333 2:109832994-109833016 ATATATGTTTACTTTTATTAAGG - Intronic
936214364 2:110538491-110538513 ATATATGTTTACTTTTATTAAGG + Intronic
936423500 2:112393054-112393076 ATATATGTTTACTTTTATTAAGG + Intronic
936776499 2:115980427-115980449 TTCTATGCTTAGTTTGCTGAGGG + Intergenic
937290001 2:120776446-120776468 GTAGATGCATATTTTTCTTCTGG + Intronic
939766071 2:146251919-146251941 TTATATGCTTATTTTTATGAAGG - Intergenic
939872649 2:147542060-147542082 GTATTTACTCAGTTTACTTAGGG - Intergenic
941295228 2:163730104-163730126 GGGTATGCTAAGTTTCCTTAGGG - Intronic
941590265 2:167410971-167410993 ATATATGCTCCTTTTTCTTAAGG - Intergenic
942912575 2:181263615-181263637 GTATATGTTTAATATTATTATGG + Intergenic
943210324 2:184956177-184956199 CTATGTTCTTAGTTTTCTTCTGG - Intergenic
943845421 2:192639583-192639605 TTCTATACTAAGTTTTCTTAAGG - Intergenic
945474707 2:210267261-210267283 GTACATCCTTACTTTGCTTAGGG - Intergenic
945686954 2:212983141-212983163 TTCTATTTTTAGTTTTCTTAAGG - Intergenic
945827132 2:214735634-214735656 AAATCTGCTTAGTTTTCTAAAGG + Intronic
948799061 2:240422455-240422477 GTTTATTCTTAGTTGTTTTAAGG - Intergenic
1169617598 20:7466951-7466973 TTTTATGCCTAGTTTTTTTAGGG + Intergenic
1174813693 20:53668676-53668698 GTTTTTTTTTAGTTTTCTTAAGG + Intergenic
1176359072 21:5978482-5978504 TTCTATCCTTAGTTTTTTTAAGG + Intergenic
1176836854 21:13800775-13800797 ATATTTTCTAAGTTTTCTTACGG - Intergenic
1177621851 21:23605805-23605827 GTTTGTTCTTACTTTTCTTAAGG - Intergenic
1177783874 21:25648693-25648715 GTATATTCTTTATTCTCTTATGG + Intronic
1179268556 21:39828512-39828534 GTATATGCTGATTTTGCTGAGGG + Intergenic
1179764446 21:43560068-43560090 TTCTATCCTTAGTTTTTTTAAGG - Intronic
1181380867 22:22502592-22502614 GTTTGTACTTAGTTTTTTTATGG - Intronic
1181546464 22:23605344-23605366 GTGTAGGCTTAGGTTTCCTAGGG + Intergenic
1181875062 22:25934133-25934155 GCATATGCTTATTTTTCTGTTGG + Intronic
949127288 3:461314-461336 GTATACGCCTGGTTTTCTTTCGG - Intergenic
951312086 3:21139242-21139264 ATGTATGCTTATTTTTATTAAGG - Intergenic
951344354 3:21528927-21528949 TTATATTCTTCTTTTTCTTAAGG - Intronic
951366588 3:21790762-21790784 GCATATGCTTAATTCTCATATGG - Intronic
951413416 3:22393507-22393529 ATATATGCTTAATTTGCTAAAGG - Intergenic
952432052 3:33233399-33233421 GTATATGATAAGTATTCTTCTGG - Intergenic
953281107 3:41558343-41558365 GTAAGTGCATATTTTTCTTAGGG + Intronic
956990396 3:74756378-74756400 ATAGATGCTGAGTTTTCATAAGG - Intergenic
957118361 3:76056630-76056652 GTGTATGCTAAGTATTCTGAAGG - Intronic
959524099 3:107356622-107356644 GTTTAAGCTTAGTGCTCTTATGG + Intergenic
959569094 3:107863043-107863065 GTATATTCTCAGTTTTCATTTGG + Intergenic
960595991 3:119408662-119408684 GTAAATGGTAATTTTTCTTAAGG + Intronic
960686316 3:120297541-120297563 GTGCATGCTTGGTTTTCTTTTGG + Intergenic
960736001 3:120781408-120781430 ATATATGCTTCCTTTTCTTCTGG - Exonic
963476567 3:145812449-145812471 GAATATAGTAAGTTTTCTTATGG + Intergenic
963624037 3:147648267-147648289 GAATTTGCTTAATTTTCTTCAGG + Intergenic
963904230 3:150760866-150760888 GTATTTGCATAGTTGTCTTAGGG - Intronic
964516681 3:157517740-157517762 TTATAATCTTAGTTTTTTTATGG + Intronic
964593384 3:158392924-158392946 GAATTTGCTGAGTTGTCTTATGG - Intronic
967456236 3:189689728-189689750 GTATATTTTTAATTGTCTTAAGG + Intronic
971560124 4:28068755-28068777 GTATATCCTCACTTTTCTTTTGG - Intergenic
971999880 4:34018048-34018070 GTATTTCCTAAGTTTTCTTCTGG + Intergenic
972024385 4:34358952-34358974 GTATAAGGCTAGTTTTCCTAAGG + Intergenic
972371149 4:38424608-38424630 GTATCTGATCAGTTTTCTTCAGG - Intergenic
972943353 4:44223954-44223976 GTATCTGCAAACTTTTCTTAAGG - Intronic
973021731 4:45211183-45211205 GTAAATGCTTGTTTTTCTTCTGG + Intergenic
973949033 4:55991830-55991852 CTATTTTCTTAGTTTTCTTCCGG + Intronic
974104330 4:57451739-57451761 GTTTATTCCAAGTTTTCTTATGG + Intergenic
974226733 4:59055542-59055564 GTATTTTCTTAGTGTTCTTTAGG + Intergenic
974758540 4:66245328-66245350 TTCTATGCTTAGTTTGCTGAGGG - Intergenic
975410274 4:74040427-74040449 GGATGTGCTTTGATTTCTTAAGG - Intergenic
976491117 4:85671630-85671652 GAATATGCTTCTTTTTCTTCTGG + Intronic
976829221 4:89294902-89294924 GTATATGATTATTTTTCCTTGGG - Intronic
977329364 4:95618089-95618111 GTATTTGCTAAGTTTTCTTCTGG - Intergenic
977790239 4:101091609-101091631 CCATATACTAAGTTTTCTTATGG - Intronic
979825058 4:125222543-125222565 CTATATACACAGTTTTCTTACGG - Intergenic
979833643 4:125333173-125333195 GTTTATGTTTAGCTTTCTAAAGG + Intronic
979860672 4:125689086-125689108 GTGTATCCTTAGGTTTCTTATGG - Intergenic
981012623 4:139941283-139941305 GTTTAATCTTGGTTTTCTTACGG + Intronic
981835929 4:149053298-149053320 GTCTGGGATTAGTTTTCTTAGGG + Intergenic
982487982 4:155991479-155991501 ATATATATATAGTTTTCTTAAGG + Intergenic
982649613 4:158071159-158071181 GAAAATGCTTAATTTTTTTAAGG - Intergenic
983482651 4:168294091-168294113 GTATATGTGTAGGTTTTTTATGG - Intronic
985064401 4:186105936-186105958 GTGTTTGTTTGGTTTTCTTAAGG + Intronic
988353726 5:30145007-30145029 CTCTACGCTTAGTTTTTTTAGGG + Intergenic
988465677 5:31489381-31489403 GTATATACTTTATTTTCTTTTGG + Intronic
989488269 5:42017926-42017948 GTAGATGATTTGTTTTCTTTTGG + Intergenic
990964871 5:61434763-61434785 GAATAGACTTAGTTTTTTTATGG + Intronic
991142837 5:63265612-63265634 GTATTTGCTAGGTTTTCTTCTGG + Intergenic
991306490 5:65181823-65181845 GGCTATGATTAGTTTTCTAACGG + Intronic
991764931 5:69965792-69965814 GCATATGTTAAGTCTTCTTAAGG + Intergenic
991773790 5:70064442-70064464 GTATATGCTCTGTTTGCTCAAGG - Intronic
991782394 5:70152361-70152383 GCATATGTTAAGTCTTCTTAAGG - Intergenic
991844163 5:70840863-70840885 GCATATGTTAAGTCTTCTTAAGG + Intergenic
991853084 5:70939866-70939888 GTATATGCTCTGTTTGCTCAAGG - Intronic
991874836 5:71152676-71152698 GCATATGTTAAGTCTTCTTAAGG - Intergenic
992462664 5:76976353-76976375 GTATTTCCTTAGTTTTGTTTAGG + Intronic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
993811638 5:92486157-92486179 GTATCTCCTCTGTTTTCTTATGG + Intergenic
998673508 5:144380861-144380883 GTATTTCCTAAGTTTTCTTCTGG - Intronic
999791397 5:154943048-154943070 CTTTCTACTTAGTTTTCTTATGG - Intronic
1000585745 5:163096438-163096460 GTATGTGATTAATTTTCCTAAGG + Intergenic
1000937034 5:167314238-167314260 GTAAATTCTTAATTTTGTTAAGG + Intronic
1001833528 5:174810066-174810088 TTATTTGCTTGATTTTCTTAGGG + Intergenic
1001957653 5:175859109-175859131 GTTTTTGCTTAGTTTTGTTTTGG - Intronic
1003353097 6:5338959-5338981 GTATATGCTTTTTGTTTTTATGG + Intronic
1004293168 6:14386838-14386860 GTTTTTGCTTCGTTTTCTTCTGG - Intergenic
1005484287 6:26284914-26284936 GAATATGTTTAGCTTTCTTGTGG - Intergenic
1007015431 6:38461647-38461669 GTATATGCTTTCTTTTCCTAGGG + Intronic
1008043749 6:46830546-46830568 GTATTTGCTTTCTTTTGTTATGG - Intronic
1008249030 6:49214964-49214986 GTATTTTCTTGGTTTTCTTCTGG - Intergenic
1008293076 6:49741806-49741828 GTATATACTTTCTTTTCTTATGG - Intronic
1009681893 6:66904857-66904879 GTATATACATAGTTTTTTCATGG - Intergenic
1010042529 6:71402740-71402762 GTAAATGCGTATTTTTCTTATGG - Intergenic
1010700778 6:79043905-79043927 ATATATATTTAGTTTTCTTTAGG - Intronic
1010845041 6:80696315-80696337 TTATAAGCTCAGTTTTCTAAGGG - Intergenic
1011487965 6:87862444-87862466 GTATCTGCTTGGTAATCTTATGG + Intergenic
1011764242 6:90602951-90602973 GTTTCTGCTATGTTTTCTTAAGG - Intergenic
1013374947 6:109505506-109505528 GAACAAGCTTAGTTTTTTTATGG + Intronic
1013945117 6:115713776-115713798 GTATATGTGTATTTTTCTGAAGG - Intergenic
1014033089 6:116730510-116730532 GTATATGTTTATTTCTTTTATGG + Intronic
1014378774 6:120713187-120713209 TTATATACTCAGTTTTTTTAGGG - Intergenic
1014919267 6:127193617-127193639 CTATGTGCTTAGTTTTCACAAGG - Intronic
1015712234 6:136154793-136154815 GTACAGGATGAGTTTTCTTAAGG + Intronic
1016155289 6:140798930-140798952 GTATATCTTTAGTTTACTTAAGG + Intergenic
1017300633 6:152853531-152853553 GTTTATGCTTAGTTTGTTAATGG + Intergenic
1018942457 6:168318876-168318898 GAATGTGCTGACTTTTCTTAAGG - Intronic
1020340212 7:7101834-7101856 GAATTTGCTTGGTTTTCTTTGGG + Intergenic
1022119181 7:27290760-27290782 GTATATGCATATTTTTCTTAGGG + Intergenic
1024035601 7:45505250-45505272 GTGTATGCTAAGCGTTCTTAAGG + Intergenic
1026803889 7:73417753-73417775 CTTTGTGCTTACTTTTCTTAAGG - Intergenic
1027446518 7:78279964-78279986 GTTTAAGCTGAGTTTGCTTAAGG - Intronic
1027906656 7:84193683-84193705 GTATGTGCTTATTTTTATTGAGG - Intronic
1028201187 7:87963684-87963706 CTGTATGCTCAGTTTTGTTAAGG + Intronic
1031110338 7:117600002-117600024 GTCTATTTTTAGTTTTCCTAAGG + Intronic
1031844646 7:126790626-126790648 GAATCCGCTTTGTTTTCTTACGG + Intronic
1032871340 7:135989234-135989256 ATAAATGCTTACTTTTCTTTAGG + Intergenic
1032981468 7:137288753-137288775 GTATAACTTTAGTTTTCTTGAGG - Intronic
1033601215 7:142889565-142889587 GTATATGTATAGTTTTTTTCTGG + Intergenic
1036100531 8:5778015-5778037 GTATATGTTTATTTTTATGAGGG + Intergenic
1037554477 8:20008903-20008925 GTATGTGCTAAGTTTGCTTCTGG - Intergenic
1038906928 8:31915263-31915285 GTATATAGTTATTTTTCCTAAGG + Intronic
1040048281 8:42985232-42985254 GTATATCCTTGGTTTTCCTTAGG - Intronic
1040091728 8:43405611-43405633 GGATATGCTGATTTTTGTTAAGG + Intergenic
1040384216 8:46902613-46902635 CTATAAGATTAGTTTTATTATGG + Intergenic
1040852447 8:51914915-51914937 GCATATGTTTAGGTTTTTTAAGG + Intergenic
1041593446 8:59618773-59618795 TTATATGCTTATTGATCTTAAGG - Intergenic
1045113609 8:98956999-98957021 GTTTCTGCTTAGTTTTTTAAAGG - Intergenic
1046111088 8:109725925-109725947 GTATATGCTTTGTTTGTTGAGGG - Intergenic
1046292245 8:112178530-112178552 TTATTTACTTATTTTTCTTAAGG + Intergenic
1046694143 8:117319560-117319582 TTGTTTGCTTAGTTTTTTTAAGG - Intergenic
1050065589 9:1756218-1756240 GTAAATGCTGACATTTCTTAGGG - Intergenic
1050192899 9:3047234-3047256 TATTTTGCTTAGTTTTCTTATGG - Intergenic
1050229428 9:3503871-3503893 TTATACCCTTAGTTTACTTATGG - Intronic
1050863027 9:10460555-10460577 GTATATGTTTAGATTTATTTTGG - Intronic
1050872716 9:10593783-10593805 AAATAGGCTTAGTTTTTTTATGG - Intronic
1051475308 9:17500985-17501007 GAATATGATCAGTTCTCTTATGG - Intronic
1052540770 9:29809496-29809518 GTATATGCTAGGTTTACTTCTGG - Intergenic
1053566298 9:39256284-39256306 GTATTTGTATACTTTTCTTACGG - Intronic
1053904217 9:42825158-42825180 GTATATGCTTTATTTTGTTGTGG + Intergenic
1054130851 9:61362729-61362751 GTATTTGTATACTTTTCTTACGG + Intergenic
1054530767 9:66180355-66180377 GTATATGCTTTATTTTGTTGTGG - Intergenic
1055263061 9:74461586-74461608 GGATGTGCTTTGTTTTGTTAAGG + Intergenic
1055588394 9:77782593-77782615 GAGTATGTTTAGTTTTTTTAAGG - Intronic
1055846838 9:80575583-80575605 TTATATGCTTATTTTGCTGAGGG - Intergenic
1057372430 9:94486346-94486368 TTCTATGCTTAGTATTTTTAAGG + Intergenic
1060889114 9:127177137-127177159 GTAGATGCTCAATTTTCGTAGGG + Intronic
1186542532 X:10415432-10415454 GTATGTGATTACTTTTCCTAAGG - Intergenic
1186669081 X:11751031-11751053 GTATATTCTTAGAATTTTTAAGG + Intergenic
1186855124 X:13618941-13618963 GTAGATGCTTAGTTTACCCAAGG + Intronic
1187142010 X:16602832-16602854 GTATTTTCTTAGTATTATTATGG + Intronic
1188116150 X:26245016-26245038 GTATAGACTTAGTTTTCTTAGGG - Intergenic
1188956778 X:36442873-36442895 GTACATGCCTCCTTTTCTTATGG + Intergenic
1189111827 X:38298592-38298614 TTATATGCTTTTTTTTATTATGG - Intronic
1189366094 X:40389833-40389855 GCCTAAGCTTAGTTTCCTTATGG - Intergenic
1192196277 X:69030679-69030701 GTATGTATTTAATTTTCTTATGG - Intergenic
1193077640 X:77372319-77372341 GTACATCATTATTTTTCTTAAGG - Intergenic
1193570385 X:83134216-83134238 TGATATGTTTAATTTTCTTATGG - Intergenic
1195129990 X:101841963-101841985 TTTTATGCTTAGATTCCTTATGG - Exonic
1195677194 X:107515684-107515706 GTATTTTGTTTGTTTTCTTAAGG + Intergenic
1196135516 X:112205423-112205445 ATATATGCTTCCTTTTTTTAAGG - Intergenic
1197367017 X:125575926-125575948 CTGTATGCTCAGTTTTTTTAGGG - Intergenic
1197662982 X:129193865-129193887 GTATATGCATAATCTTCTTTTGG - Intergenic
1199776683 X:151018008-151018030 ATATATGAGTGGTTTTCTTAAGG - Intergenic