ID: 1100260556

View in Genome Browser
Species Human (GRCh38)
Location 12:92928962-92928984
Sequence GAGGAGGGGCGCCCGCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 297}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100260539_1100260556 27 Left 1100260539 12:92928912-92928934 CCTAAGCGCCTGCCGGGCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1100260556 12:92928962-92928984 GAGGAGGGGCGCCCGCGCCGCGG 0: 1
1: 0
2: 2
3: 28
4: 297
1100260549_1100260556 2 Left 1100260549 12:92928937-92928959 CCTAGGGAAGGAAGGAGCCCGCG 0: 1
1: 0
2: 1
3: 22
4: 175
Right 1100260556 12:92928962-92928984 GAGGAGGGGCGCCCGCGCCGCGG 0: 1
1: 0
2: 2
3: 28
4: 297
1100260543_1100260556 19 Left 1100260543 12:92928920-92928942 CCTGCCGGGCTGTGGGGCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 258
Right 1100260556 12:92928962-92928984 GAGGAGGGGCGCCCGCGCCGCGG 0: 1
1: 0
2: 2
3: 28
4: 297
1100260546_1100260556 15 Left 1100260546 12:92928924-92928946 CCGGGCTGTGGGGCCTAGGGAAG 0: 1
1: 0
2: 3
3: 52
4: 435
Right 1100260556 12:92928962-92928984 GAGGAGGGGCGCCCGCGCCGCGG 0: 1
1: 0
2: 2
3: 28
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100260556 Original CRISPR GAGGAGGGGCGCCCGCGCCG CGG Intronic
901024062 1:6269887-6269909 GAGGAAGGCCGCCCGCACCTTGG - Intronic
901045506 1:6393436-6393458 GAGGCGGGGCCTGCGCGCCGGGG + Intronic
901279933 1:8026162-8026184 GAGGAGCGGCGGCTGCCCCGCGG + Exonic
901523977 1:9807770-9807792 GAGGAGGGGCCCCCATGCCCAGG - Intronic
901577302 1:10210945-10210967 GGGGAGGAGCGGCCGGGCCGGGG + Intronic
901628848 1:10638626-10638648 GGGGAGGGGCGCCGGGGCAGCGG + Exonic
902392558 1:16115011-16115033 GACCATGGGCGCCCGGGCCGGGG - Intergenic
902873669 1:19328612-19328634 GAGGAGGGGCTCAAGCTCCGAGG - Exonic
902896756 1:19485079-19485101 GAGGAAGGGGGCCCACGCCAGGG + Intronic
902896874 1:19485392-19485414 CCGGAGGGGCCCCCGGGCCGGGG + Intronic
902920690 1:19664828-19664850 GAGGCGGGGCGCACGCTCCGCGG + Intergenic
903321935 1:22548522-22548544 GAGGAGGGGCCCCCACTCCCAGG - Intergenic
904528809 1:31155026-31155048 GAGGGGCGGAGCCCGGGCCGGGG + Intergenic
904768964 1:32870618-32870640 GGGGCGGGGGGCCGGCGCCGGGG - Intronic
904769084 1:32870960-32870982 GGGGCGGGGCGCCCCCGCTGCGG + Intronic
905202337 1:36323231-36323253 CTGGAGGGGCGTCCGCGCCCGGG - Intronic
905685058 1:39901930-39901952 GAGGGAGGGCGCGCGCGCGGGGG - Exonic
908605467 1:65792992-65793014 GGGAAGGGGCGCGCGGGCCGGGG - Intronic
912411545 1:109483873-109483895 GGGGAGGCGTGCCCGCGACGGGG + Intronic
912790003 1:112640525-112640547 CAGGAGGGGCGGCCGGGCAGAGG - Intronic
914013005 1:143793515-143793537 GGGGAGGGGCCCTCCCGCCGTGG + Intergenic
914164820 1:145167670-145167692 GGGGAGGGGCCCTCCCGCCGTGG - Intergenic
914651630 1:149702124-149702146 GGGGAGGGGCCCTCCCGCCGTGG + Intergenic
915410859 1:155700620-155700642 CAGTAGGGGCGGCCGGGCCGAGG - Intronic
915526437 1:156479237-156479259 GGGGAGGGGTGCCCGCTCAGTGG - Intronic
920511787 1:206557240-206557262 GAGGGAGGGCGCTGGCGCCGGGG + Intronic
920528589 1:206685605-206685627 GCGGAGGGGTGGCCGCGGCGGGG + Intronic
922196435 1:223363999-223364021 GAGGAGGCGCGCGCAGGCCGGGG - Exonic
1063458521 10:6201607-6201629 CAGGGAGGGCGCCCGCGCCCAGG - Intronic
1064230986 10:13529053-13529075 GAGGAGGGGCGCCGGCGGAGGGG + Intergenic
1064712413 10:18140680-18140702 GAGGAGGGGACCCGCCGCCGGGG + Exonic
1065101247 10:22335094-22335116 GAGGAGGGGTGGCTGCGCGGCGG + Intergenic
1067110624 10:43397157-43397179 GGGCCGGGGCGCCCGCGCGGCGG + Intronic
1067111937 10:43407453-43407475 GGGGAGGGGTTCCCGCGCCCGGG + Intronic
1067769843 10:49115371-49115393 GGGGCCGGGCGGCCGCGCCGGGG - Intronic
1068538599 10:58267775-58267797 GCAGAGGAGCGCCCGCGCCCCGG - Exonic
1070032785 10:72692795-72692817 GACGAGGGGCGGCCCCGCCGGGG - Intronic
1070570786 10:77638178-77638200 GCGCAGGGGCGCCCGGGCGGAGG - Intronic
1071527155 10:86365461-86365483 GAGGAGGAGGGGGCGCGCCGAGG - Intronic
1072188509 10:93063033-93063055 TGGGAGGCCCGCCCGCGCCGCGG - Intronic
1072241123 10:93496530-93496552 GAGGAGCAGCGCGCGCGCGGCGG - Intergenic
1072591470 10:96832202-96832224 GAGGCGCGACGCCCGGGCCGCGG + Intergenic
1072673040 10:97445805-97445827 GAGGAGGGCAGCCCGGGCAGCGG - Exonic
1073325844 10:102643729-102643751 GAGGCCCGGCGCCCCCGCCGCGG - Intergenic
1074522619 10:114239457-114239479 CAGGAGGGGCGCCCGGGGCGCGG - Exonic
1075119057 10:119651294-119651316 GGGGAGGGGCGAGCGGGCCGAGG + Intergenic
1075375348 10:121974519-121974541 GAGGCCGGGAGCCCACGCCGAGG + Intronic
1075697537 10:124447853-124447875 AAGGCGGTGCGCGCGCGCCGCGG + Exonic
1077063425 11:627311-627333 GCCGAGGGGCGCCAGCGCGGCGG - Intergenic
1077306653 11:1871657-1871679 CAGGAGGGGTGCCCGTGCAGCGG - Intronic
1077395050 11:2316519-2316541 GGGGAGGGGCGCCCGCACCCTGG + Intronic
1077495334 11:2884398-2884420 GGGGAGGGGCTCCCGCGGCCGGG + Intronic
1078575386 11:12497686-12497708 GAGGAGGGGAGGCCGTGCCCTGG + Intronic
1084186920 11:67477995-67478017 CAGGAGGGGCGGCCGGGCAGAGG + Intergenic
1085784764 11:79439931-79439953 GAGGAGAGGCGGGCGCCCCGCGG + Intronic
1086349841 11:85934702-85934724 GAGGCTGGGCGCCCGCCCAGTGG - Intergenic
1087348426 11:97000659-97000681 GAGGCGGGGCGCCCCAGCAGGGG + Intergenic
1091616092 12:2052595-2052617 GAGGGGGTGTGTCCGCGCCGCGG + Intronic
1091730524 12:2877082-2877104 GGGGAGGGGGTCCCGGGCCGGGG + Intronic
1092743133 12:11649454-11649476 GAGGGCGGGCGCCCGCACCGGGG + Intergenic
1094624065 12:32106619-32106641 GCGGTGGGGCGCGCGCGGCGGGG - Intergenic
1096260224 12:50085560-50085582 GAGGAGGGGCGCGCGGGCCGGGG + Intronic
1096435930 12:51591150-51591172 CAGTAGGGGCGCGCGCGCGGTGG + Intronic
1100260556 12:92928962-92928984 GAGGAGGGGCGCCCGCGCCGCGG + Intronic
1100570353 12:95840657-95840679 CAGTAGGGGCGGCCGGGCCGAGG + Intergenic
1101910597 12:108857735-108857757 GAGGAGGCGCGCGTGCGCGGGGG + Intergenic
1102822133 12:115917117-115917139 GAGTCGGGGCCCCCGGGCCGCGG - Intergenic
1103299807 12:119918720-119918742 CAGTAGGGGCGGCCGGGCCGAGG + Intergenic
1103364067 12:120369460-120369482 GCGGCCGGGCCCCCGCGCCGGGG - Intergenic
1103563408 12:121804118-121804140 AAGGGGGGGCGCCGCCGCCGCGG - Intergenic
1103649709 12:122422841-122422863 GCGGAGCGGCGGGCGCGCCGGGG - Intergenic
1103682896 12:122708820-122708842 CAGGAGGGGCGGCCGGGCAGAGG + Intergenic
1104428271 12:128695858-128695880 GAGGAGGAGCGGCGGGGCCGGGG + Exonic
1104901165 12:132190205-132190227 GAGGAGGAGCGGCCGCGCGGCGG - Intergenic
1105943483 13:25170955-25170977 GCGGAGGGGCGCGCGCCCGGGGG - Exonic
1106224359 13:27773959-27773981 GAGGAGGGGCACCAGCGTTGTGG + Intergenic
1111975959 13:94967792-94967814 GACTCGGGGCGCCGGCGCCGGGG + Intergenic
1113762426 13:112858978-112859000 GAGGAGGGCCTGCCGTGCCGCGG + Intronic
1113954933 13:114094861-114094883 GAGCGGGGGAGCCCGCGCCTCGG - Intronic
1113962116 13:114132137-114132159 GAGGTGGGGTCCCTGCGCCGAGG - Intronic
1115028481 14:28767714-28767736 GGAGAAGGGCGCCGGCGCCGGGG + Exonic
1118285382 14:64465776-64465798 GATGAGGGTCGCCCTGGCCGCGG - Intronic
1118289017 14:64503833-64503855 AAAGAGGGGCGCCAGGGCCGGGG + Exonic
1118292924 14:64541976-64541998 GAGGATGGCCGCCTGCACCGCGG - Exonic
1121557460 14:94849213-94849235 GAGGAGGGGCGACAGGGCCCTGG - Intergenic
1122230974 14:100306241-100306263 GAGGAAAGGCGGCCTCGCCGGGG - Exonic
1122568405 14:102677093-102677115 CAGTAGGGGCGGCCGGGCCGAGG + Intronic
1122736761 14:103847773-103847795 GGGGAGGGGCGGACGCGCAGTGG + Intergenic
1122888891 14:104723730-104723752 CAGGGGGCGCGCCCGCGCCCAGG + Intergenic
1122975403 14:105168822-105168844 GAGGGGGCGGGGCCGCGCCGCGG + Exonic
1123024832 14:105419726-105419748 GGGAAGGGGCGCGCGGGCCGCGG + Intronic
1125862970 15:43015072-43015094 CAGTAGGGGCGGCCGGGCCGAGG - Intronic
1126668474 15:51094868-51094890 GAGGGGAGGCGCGAGCGCCGAGG + Intronic
1128269211 15:66293810-66293832 GAGGCGGAGCGCCAGCGGCGGGG + Intronic
1128647196 15:69386631-69386653 GAGGAGGGGAGCCAGCCCAGGGG - Intronic
1128992567 15:72272805-72272827 GGGGGGTGGCGCCTGCGCCGTGG + Intronic
1129810678 15:78507554-78507576 GAGGAGGGGCGCGGGCGCTGCGG + Intronic
1130894578 15:88160186-88160208 AAGGAGGGGCGCCCCAGCCATGG + Intronic
1131432104 15:92395278-92395300 AAGGAGGGGCGCACGCGGCGCGG - Intronic
1132687218 16:1167354-1167376 GCGGGGTGGCGCCCGGGCCGCGG + Intronic
1132733852 16:1376078-1376100 GAGGAGGAGCGCCCCAGCCCTGG - Intronic
1132733873 16:1376140-1376162 GAGGAGGAGCGCCCCAGCCCTGG - Intronic
1132733905 16:1376238-1376260 GAGGAGGAGCGCCCCAGCCCTGG - Intronic
1132789693 16:1678599-1678621 GGGGAGGGGCGCCCGGGCTCTGG + Intronic
1133097663 16:3458244-3458266 TAGGCGGGGAGGCCGCGCCGGGG + Intronic
1134135080 16:11672358-11672380 GAGGAGGGGCGCCTGGGTCCAGG + Intronic
1137926719 16:52547324-52547346 GAGAGGGGGCGGCCGCGGCGGGG - Intronic
1138328120 16:56191941-56191963 GAGGAGGCGCCCGCGGGCCGAGG - Intronic
1138444493 16:57054955-57054977 GAGGAGGGGTGCTGGCCCCGTGG + Intronic
1139750758 16:69107593-69107615 GAGGCGGGGCGCCAGCGCCCAGG + Exonic
1140478551 16:75250879-75250901 GAGTGGGGGCGGGCGCGCCGCGG - Intronic
1141423474 16:83931503-83931525 GAGGAGGGGCTCCTGGGCGGTGG + Intronic
1141841994 16:86579322-86579344 GTGGAGGGGCGCCGGCGGAGAGG - Exonic
1142636328 17:1260076-1260098 GAGCTGGGGCGCCCGCGTTGGGG - Intergenic
1142683222 17:1562309-1562331 GTGGAGGGGCGGCCGGGGCGTGG - Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1146901376 17:36591790-36591812 GGGGCGGGGCGGCCGGGCCGCGG + Exonic
1146955858 17:36936115-36936137 GAGGCGCGGCGCCGGCGCGGGGG - Intergenic
1147931506 17:43984155-43984177 TAGGGGGGGCGCCAGCCCCGGGG + Intronic
1149659028 17:58324823-58324845 GAGCAGGGGCGCCTGCTCCCGGG - Exonic
1150168333 17:62966149-62966171 GGGGAGGGGCGCGAGCGCGGAGG - Intergenic
1152174886 17:78781486-78781508 GAGGAGCGGCGTCCCCACCGCGG + Intronic
1152175039 17:78781988-78782010 GATGAGGGTCGCCGGGGCCGGGG - Intronic
1152571781 17:81124201-81124223 AGGGAGGGGCGCCCACCCCGGGG + Intronic
1152618010 17:81346548-81346570 GAGGAGGTGGCCCCGCGTCGGGG + Intergenic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1152918129 17:83052355-83052377 GAGGAAGGGTGCCCGGGGCGAGG + Intergenic
1153855138 18:9137338-9137360 GGTGAGGGGCGCCCGCGACGAGG - Intronic
1154303869 18:13217408-13217430 GGGGAGGCGCGCGGGCGCCGAGG - Intergenic
1156350735 18:36298650-36298672 GAGGAGGGGCGGGGGCGCGGAGG + Intronic
1157496715 18:48161839-48161861 GGGGAGGGGCGCCCGGGAGGAGG - Intronic
1157529400 18:48409012-48409034 GAGCAGGGGCGCCCTCCGCGCGG - Intronic
1157773841 18:50374952-50374974 AAGGAGGGGTGGCCGAGCCGGGG - Intergenic
1158427463 18:57352691-57352713 GAGGAGGGGGACCCGGGCGGGGG - Exonic
1160025430 18:75211787-75211809 GCGGAGTTGCGCCCGCGCCCGGG + Intronic
1160499666 18:79395650-79395672 GAGGGGGGGCGCCCGGGGAGGGG - Intergenic
1160592222 18:79951218-79951240 GGGGAGGGGTCCCAGCGCCGGGG + Intronic
1160745463 19:709154-709176 GAGTAGGCGCGCTCGGGCCGCGG + Intronic
1160810871 19:1012410-1012432 GAGGAGGGGAGGCCCCGCCATGG + Intronic
1160863973 19:1249246-1249268 GGGGCGGGGCGCCCGCACCTCGG - Intronic
1161063810 19:2227962-2227984 GAGGACGGGCGGCCCCGCGGGGG - Intronic
1161069016 19:2251272-2251294 GAGTAGGCGCTCCAGCGCCGCGG - Exonic
1161139986 19:2641506-2641528 GAGGAGGGGGCCCCGAGCCAAGG + Intronic
1161289032 19:3483080-3483102 GAGGAGGGTGGCCGGGGCCGGGG - Intergenic
1161557735 19:4954053-4954075 GAGGAAGGGGCCCCGAGCCGAGG + Intronic
1161558014 19:4955332-4955354 GAGGAAGGGGCCCCGAGCCGAGG - Intronic
1161681261 19:5680988-5681010 GAGGCGGGGCGTCCGCCCAGTGG + Intronic
1161686266 19:5704176-5704198 GAGGAAGGGGCCCCGAGCCGAGG + Intronic
1162479981 19:10922311-10922333 GGGGAGGGGTGGCCCCGCCGAGG + Exonic
1162550532 19:11355727-11355749 GGGGAGGGGACCCCGGGCCGAGG + Intronic
1162954858 19:14091981-14092003 GAGGAGGGGCGCCCAGGATGGGG + Exonic
1163681281 19:18683928-18683950 GGGGCGGGGCGCGCGCGGCGGGG + Intronic
1164834888 19:31350208-31350230 GAGGAGGCGGGCGCGGGCCGGGG + Intergenic
1165157135 19:33795750-33795772 GGGGAGGGGCGTCCGGGGCGCGG + Intergenic
1165827575 19:38714045-38714067 GAGCAGGGGCGCCCGGGTCCCGG - Intronic
1167649050 19:50719637-50719659 GAGGAGGGGCGCGGCGGCCGCGG - Intergenic
1167889496 19:52528149-52528171 GAGGAGGGGGGACGGCGCCTTGG - Intronic
1168337687 19:55605671-55605693 GAGGAGGCGCCGCCGCTCCGGGG - Intronic
1168354370 19:55692408-55692430 GGGGAGGGGTGGCCGAGCCGTGG + Intronic
1168462077 19:56567674-56567696 GAGGAGGGGCGAGCGCGCGCGGG + Exonic
1168471271 19:56642984-56643006 GAGGCGGGGTACCCGCGGCGTGG - Intergenic
927714364 2:25342318-25342340 GAGGCGGGGCGCCCGGGGCCCGG - Intronic
927755660 2:25705882-25705904 CAGAAGGGGCGGCCGGGCCGAGG - Intergenic
927938231 2:27087131-27087153 GAGGAGGAGCTCCCACGCGGAGG + Exonic
929604699 2:43226653-43226675 GCGGCGGGGCGGGCGCGCCGGGG + Intergenic
929789795 2:45014074-45014096 GCGGAGGGGCGCGGGCGCGGCGG + Intergenic
929857846 2:45651236-45651258 GAGGGCGGGCGCCGGCGCCCAGG + Intergenic
931681132 2:64750833-64750855 GAGCAGGGGCGGCCGCGGCGGGG + Intronic
931727977 2:65129707-65129729 GCGGAGGGGCGGCCGCGCGGGGG - Intronic
932036561 2:68252259-68252281 GGGGAGGGGAGGCGGCGCCGCGG + Exonic
932591531 2:73070817-73070839 GCGGAGGGTCTCCCGCGCCCGGG - Intronic
933886299 2:86721114-86721136 GACGAGGGGCGCCCACTCGGGGG - Exonic
933923880 2:87075592-87075614 GACGAGGGGCGCCCACTCGGGGG + Intergenic
935595191 2:104872627-104872649 GCGGAGGGGAGCCCGCGGCCTGG - Intergenic
937919397 2:127119595-127119617 CAGTAGGGGCGCCCGGGCAGAGG + Intergenic
938319791 2:130355515-130355537 GGGGAGGGGCAGCCACGCCGTGG - Intergenic
942116781 2:172735882-172735904 GAGGAGCGGGGTCCGCGCGGCGG + Exonic
942653772 2:178194454-178194476 GAGGAGGGGCTGCAGCGCAGCGG + Intergenic
946354584 2:219176930-219176952 GAGGACGGCGGCCCGCCCCGGGG - Intronic
947800935 2:232928209-232928231 CGGGAGGGGCGCGCGCGGCGGGG + Intronic
948046835 2:234951885-234951907 GAGGGGGTGGTCCCGCGCCGGGG - Intergenic
948880150 2:240852521-240852543 GAGGAGAGGCGGCCGCGGCAGGG - Intergenic
948953975 2:241272832-241272854 GAGGCGCGGCGCCCGGGCCCCGG + Exonic
948958856 2:241316114-241316136 GGGGAGGGGCGGCCGAGCCCAGG + Intronic
949035638 2:241814652-241814674 GAGGAGGGGCACGCTGGCCGGGG + Exonic
1168760638 20:347571-347593 GAGAAGGGGCGCCCTCCCGGGGG - Intronic
1168855153 20:1002708-1002730 GAGCAGGGGAGCGCGGGCCGCGG - Intergenic
1169370921 20:5027866-5027888 CAGTAGGGGCGGCCGGGCCGAGG - Intergenic
1170204686 20:13785285-13785307 GAGGAGGTGAGCCCGCGGGGCGG + Exonic
1171767113 20:29296532-29296554 GAGGAGGGGCGCTGGAGCGGTGG + Intergenic
1171810152 20:29740949-29740971 GAGGAGGGGCGCTGGAGCAGCGG + Intergenic
1173165968 20:40687726-40687748 GAGGAAGGGCGCGCGGGCCGCGG - Exonic
1174579585 20:51562382-51562404 GCGGAGGGGCGCCCGCGCCCCGG - Intronic
1174874026 20:54208326-54208348 GAGGCGGGGCGCCGGGGCTGGGG + Intronic
1175898359 20:62350169-62350191 GAGGAAGGGCGCGGGAGCCGGGG - Intronic
1176125057 20:63471583-63471605 AGGGAGGGGCGTCGGCGCCGAGG + Intronic
1176126663 20:63478590-63478612 GGGGAGGGGACCCCGCGCCAGGG - Intergenic
1176548923 21:8213314-8213336 GAGGAGGGGCGCGGGAGCGGCGG - Intergenic
1176556818 21:8257527-8257549 GAGGAGGGGCGCGGGAGCGGCGG - Intergenic
1176567852 21:8396347-8396369 GAGGAGGGGCGCGGGAGCGGCGG - Intergenic
1176575757 21:8440568-8440590 GAGGAGGGGCGCGGGAGCGGCGG - Intergenic
1177431729 21:20998416-20998438 GAGGAGGAGCGCGCGGGCTGCGG + Exonic
1178707979 21:34889983-34890005 GGCGAGGGACCCCCGCGCCGGGG - Intronic
1179422452 21:41247649-41247671 GAGGCGGGGCGGCGGGGCCGTGG + Intronic
1180875202 22:19171895-19171917 CAGGAGGGTCGCCTGCGCTGAGG - Intergenic
1181512314 22:23394463-23394485 GGGGAGGGGAGCCCACTCCGAGG - Intergenic
1182664020 22:31944486-31944508 GAGGAGACGCGGCCGCGCTGGGG - Exonic
1183071520 22:35399867-35399889 GCGGAGGGGCGGGCGCGCGGAGG - Intergenic
1183294140 22:37019809-37019831 GGGGAGGGGGCGCCGCGCCGCGG + Intronic
1183427211 22:37746329-37746351 GCGGCGGGGTTCCCGCGCCGCGG + Intronic
1183467256 22:37985997-37986019 GAGGAGGGTTGGCAGCGCCGGGG - Intronic
1183590592 22:38777302-38777324 GAGGTGGGGAGCAGGCGCCGAGG - Intronic
1184276370 22:43411673-43411695 GAGGAGCGGGGCCCGCGCTGCGG - Intronic
1185397683 22:50601026-50601048 GGGGTGGGGCGCCCGAGCCGAGG - Intronic
1203253808 22_KI270733v1_random:129622-129644 GAGGAGGGGCGCGGGAGCGGCGG - Intergenic
1203261864 22_KI270733v1_random:174701-174723 GAGGAGGGGCGCGGGAGCGGCGG - Intergenic
951907963 3:27722165-27722187 GAGGAGAGGGGGCCGCGCTGGGG + Exonic
953492676 3:43364229-43364251 GAGGAGGGAGGCCCACGCCAGGG - Intronic
954215647 3:49122964-49122986 GAGGATGGGCAGCCGCGCTGTGG - Exonic
954676255 3:52317311-52317333 GAGGGTGGGCGCCCGAGCCGAGG + Intronic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
960096582 3:113696155-113696177 GATGAGGGGTGCGCTCGCCGCGG + Intronic
966849339 3:184155279-184155301 GCGGAGAGGCGCCGGCGTCGCGG - Intronic
969115028 4:4866015-4866037 GCGGAGGCGCGCGCGGGCCGGGG - Intergenic
969417183 4:7068347-7068369 GGGGTGGGGCGCGCGCGTCGCGG + Intergenic
971244127 4:24913057-24913079 GAGGAGGGGCGCGGCCGCCGGGG + Intronic
972162555 4:36244406-36244428 GAGGCGGGGAGCGCGGGCCGCGG + Exonic
972817179 4:42657141-42657163 GAGCTCGGGCGCCGGCGCCGGGG + Intergenic
973293160 4:48490133-48490155 GAAGAGGGGCCCCCTCGGCGGGG + Intergenic
973758921 4:54100008-54100030 GAGGAGGGGCGGGCGCGCGGCGG - Intronic
974047244 4:56908251-56908273 GGGGAGGGCCGCCCGGGCGGCGG + Intronic
976068318 4:81214974-81214996 ACGCAGGGGCGGCCGCGCCGAGG - Exonic
976297250 4:83484870-83484892 GAGGAGGCGCGGCGGCGTCGGGG + Intronic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
978749619 4:112232060-112232082 GAGGAGGAGCGGCGGCGCCTGGG + Exonic
979685352 4:123505750-123505772 GAGGTGGTGCGCCGGGGCCGCGG + Intergenic
985129224 4:186724450-186724472 GAGGCCAGGCGCCCGCGGCGGGG - Intronic
985629860 5:1008779-1008801 GAGCGCGTGCGCCCGCGCCGGGG - Intergenic
990003727 5:50922542-50922564 GGGGTGGGGGGCCCGGGCCGAGG - Intergenic
992597576 5:78361106-78361128 GCGGAGGGGGGCCCGCCCTGGGG + Intronic
993259322 5:85638881-85638903 GGGGAGGGGCGCCCGCCACTGGG + Intergenic
993261522 5:85663189-85663211 GGGGAGGGGCGCCCGCCACTGGG - Intergenic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
993900565 5:93581588-93581610 GAGGAGCGGGTCCCGCGGCGGGG - Intergenic
996329380 5:122312116-122312138 GGGGAGCGGCGCCCGCGGCCGGG + Exonic
996379054 5:122845545-122845567 GAGGCGGGGCGGCCCGGCCGTGG + Exonic
996717781 5:126601330-126601352 GAGGCGGGGCGCGCGAGCCCTGG + Intronic
997120186 5:131165308-131165330 TAGGTGGGGCGCCAGAGCCGGGG - Exonic
997284399 5:132667980-132668002 CAGGAGGGGAGCACGGGCCGAGG - Intergenic
997652888 5:135535464-135535486 CAGGAGAGGCGGCGGCGCCGCGG - Exonic
997654266 5:135543952-135543974 CACGAGAGGCGACCGCGCCGCGG + Intergenic
998374516 5:141682065-141682087 GGGGAGGGCCGCCGGCGCCGAGG + Intronic
1003175663 6:3751109-3751131 GACGAGGGGTGCCCGGGCGGCGG - Intronic
1003175781 6:3751585-3751607 CAGGAGGCGCGCCCCGGCCGGGG + Exonic
1003868681 6:10384871-10384893 GCGGAGCGGCTCCCGCGCCCCGG - Intergenic
1005606975 6:27485473-27485495 CAGTAGGGGCGGCCGGGCCGAGG + Intergenic
1005940762 6:30557548-30557570 GAGGAAGGGCGCACGCGCTGGGG + Intronic
1006058178 6:31400887-31400909 GGGGAGGGGCGCCCAGGCCTGGG + Intronic
1006599034 6:35213765-35213787 GGGGAGCGGCCACCGCGCCGAGG + Intergenic
1007169978 6:39856095-39856117 GAGGAGGGGCGACAGCGGGGTGG + Intronic
1007485633 6:42178907-42178929 GAGGAGGGGCTCCCCAGCGGAGG + Intronic
1008034866 6:46735155-46735177 GAGGAGGGGCCCCGGGGGCGAGG - Intronic
1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG + Intergenic
1011195323 6:84774337-84774359 GAGTCGGGGCGCGGGCGCCGCGG - Intergenic
1017793703 6:157823303-157823325 GAGGAGCGGCCGCCGCGCCGGGG + Exonic
1018888799 6:167965903-167965925 GAGGAGGGGCGCCGGGCGCGGGG - Intronic
1019111930 6:169724018-169724040 GCGGCGGGGGGCCCGCGCGGCGG - Exonic
1019134549 6:169899918-169899940 CAGGAGGGGCGCCCAGGCCCTGG - Intergenic
1019274716 7:169952-169974 GAGGTCGGGCGCCCGGGCTGAGG - Intergenic
1019344056 7:521045-521067 GAGGGAGGGCGACCGCGACGGGG - Intergenic
1019689643 7:2403552-2403574 TAGGAGGGGCTCCTGCGCCGGGG + Exonic
1020105245 7:5419733-5419755 GGGGAGGGGCGCGCGCCCGGGGG - Intronic
1022018572 7:26376690-26376712 GTTGAGGGGCGGCCGCGCCGGGG + Intergenic
1022251756 7:28615389-28615411 GAGGAGGTGCGCCAGAGCCACGG + Intronic
1022528411 7:31052689-31052711 GTGGAGGGGCAGCCGCGGCGGGG - Intronic
1023722679 7:43112723-43112745 GCGGAGGGGCGCGCGCGGCTCGG - Exonic
1029206083 7:98870073-98870095 GAGGAGGAGGGCGCGCGGCGCGG - Intronic
1029459707 7:100687702-100687724 GAGGAGAGGGGCCAGCGCTGAGG - Intronic
1030033299 7:105388452-105388474 GGGGAGGGGCGCGCGGGCCGCGG - Intronic
1030216004 7:107044617-107044639 GGGGCGGGGCGCCCGGGCGGGGG + Intergenic
1032021662 7:128409986-128410008 GAGGAGGGGCGGGGCCGCCGGGG + Exonic
1032037476 7:128531193-128531215 GAGGCGGGGCGCCGGGGCAGCGG + Intergenic
1034223086 7:149460451-149460473 GAGGGGCGGCGCGCGGGCCGGGG - Intronic
1034522633 7:151632350-151632372 GCGGAGGGGCACGCGGGCCGCGG - Intronic
1035021844 7:155805064-155805086 AATGAGCGGCTCCCGCGCCGCGG + Intronic
1035231319 7:157467750-157467772 GAGGAATGGGGCCCGCGCCCCGG + Intergenic
1035431987 7:158829397-158829419 GATGAGCGGCGCCCGGGGCGAGG - Exonic
1037116851 8:15237424-15237446 CAGCAGGGGCGCCTGCGCCCGGG + Intronic
1037836228 8:22216259-22216281 GAGGGGAGGCGCCCGCTCTGAGG - Intergenic
1037882362 8:22579378-22579400 GAGGAGGAGCGCTCCGGCCGGGG - Exonic
1038176301 8:25184599-25184621 GAGGCCGGGCGCCCGCGGCTCGG + Intergenic
1038808006 8:30812495-30812517 GGGGAGCGGCGCCCGGGCCGGGG - Exonic
1040604870 8:48921690-48921712 TAGGAGGGGCGCAGGAGCCGGGG + Exonic
1041673649 8:60516956-60516978 GAGGCGGGGCGGAGGCGCCGCGG + Exonic
1045111482 8:98941790-98941812 GACGAGGGGCGCGCGAGCAGCGG - Intronic
1048214351 8:132481160-132481182 GAGGCGGGGCGCCGCCGCCCGGG - Intergenic
1048981615 8:139705616-139705638 GGGAAGGGGAGCCCGCGCTGTGG + Intergenic
1049166369 8:141128541-141128563 GAGGGGCGGGGCCCGAGCCGAGG - Intronic
1049494764 8:142924494-142924516 GAAGAGGGGCTCCCTCTCCGGGG + Intergenic
1049537455 8:143188938-143188960 GGGGAGGGGCACCCTGGCCGAGG + Intergenic
1049789450 8:144466138-144466160 GAGGAGGGTCGCGGGAGCCGTGG + Exonic
1053129246 9:35605716-35605738 GAGGAGGGGCGGCCCCGGCCCGG - Exonic
1053157671 9:35791918-35791940 GTGGGAGGGTGCCCGCGCCGCGG - Intergenic
1055586469 9:77762000-77762022 CAGGAGGGGCGGCCGGGCAGAGG - Intronic
1056475416 9:86947309-86947331 GACGCGGGGCGGCCGGGCCGCGG - Intergenic
1057054390 9:91949761-91949783 GAGCATGGGCGCCGGCGCAGCGG + Intronic
1057674838 9:97130534-97130556 CAGGAGGGGCGGCCGGGCAGAGG + Intergenic
1057758085 9:97853117-97853139 GGGGAGGTGCGCCCGGGCCCCGG + Intergenic
1059769799 9:117414671-117414693 CTGGAGCGGCGCCCGCGCCGGGG - Exonic
1060106788 9:120877449-120877471 GAGGATGCGCGCCCGCGGGGCGG - Intronic
1060281574 9:122219034-122219056 GTGGAGGGGTGCCCGCCCTGGGG - Intronic
1060478056 9:124000010-124000032 GGGGAGGGGCGCCGGGGCCCGGG - Intergenic
1060549357 9:124477780-124477802 GGGGAGGGGCGCTGGCCCCGGGG - Intronic
1062574496 9:137200051-137200073 GCAGGCGGGCGCCCGCGCCGCGG + Exonic
1062620271 9:137417411-137417433 CAGCAGGGGCCTCCGCGCCGCGG - Intronic
1203470208 Un_GL000220v1:112770-112792 GAGGAGGGGCGCGGGAGCGGCGG - Intergenic
1203478029 Un_GL000220v1:156742-156764 GAGGAGGGGCGCGGGAGCGGCGG - Intergenic
1185450809 X:280290-280312 GAGGAGGGGAGGCCGTGCAGGGG + Intronic
1185450872 X:280450-280472 GAGGAGGGGAGGCCGTGCAGGGG + Intronic
1187183538 X:16964976-16964998 CAGTAGGGGCGCCCGGGCAGAGG + Intronic
1188003607 X:25002922-25002944 GAGGAGGGAGGCGTGCGCCGAGG + Intergenic
1189107893 X:38256102-38256124 GAGGAGGAGCGCGAGCGCCCCGG - Intronic
1189320323 X:40083584-40083606 GGGGAGGGGCGCCCCCTCCCCGG + Intronic
1189325629 X:40109250-40109272 GGGTGGGGGCACCCGCGCCGAGG - Intronic
1199772674 X:150984257-150984279 GAGGAGTGCGCCCCGCGCCGGGG + Intronic
1199881167 X:151974936-151974958 GAGGCGGCGAGCCCGCGGCGCGG + Intergenic
1200091424 X:153637864-153637886 GCGGAGGGGCGCCCTGGCCATGG + Intergenic
1201335841 Y:12878982-12879004 CAGGAGGGGCGGCCGGGCAGAGG - Intergenic