ID: 1100273114

View in Genome Browser
Species Human (GRCh38)
Location 12:93045092-93045114
Sequence GCCTATTTCACAGTGTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100273114_1100273116 -5 Left 1100273114 12:93045092-93045114 CCAGGCAACACTGTGAAATAGGC No data
Right 1100273116 12:93045110-93045132 TAGGCAACCCTCTTGGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100273114 Original CRISPR GCCTATTTCACAGTGTTGCC TGG (reversed) Intergenic
No off target data available for this crispr